Bailey & Scott’s Diagnostic Microbiology [14 ed.] 9780323354820, 2016013977 - EBIN.PUB (2022)

Bailey & Scott’s Diagnostic Microbiology

YOU’VE JUST PURCHASED

MORE THAN

A TEXTBOOK! Evolve Student Resources for Bailey & Scott’s Diagnostic Microbiology, Fourteenth Edition, include the following: • L aboratory Manual • Review Questions • Procedures

Activate the complete learning experience that comes with your book by registering at

http://evolve.elsevier.com/Tille/micro/ REGISTER TODAY! You can now purchase Elsevier products on Evolve! Go to evolve.elsevier.com/html/shop-promo.html to search and browse for products. * Evolve Student Resources are provided free with each NEW book purchase only.

Bailey & Scott’s Diagnostic Microbiology Fourteenth Edition

Patricia M. Tille, PhD, BS, MT(ASCP), FACSc Chairperson Microbiology Advisory Group International Federation of Biomedical Laboratory Science Program Director Medical Laboratory Science South Dakota State University Brookings, South Dakota

3251 Riverport Lane St. Louis, Missouri 63043

BAILEY & SCOTT’S DIAGNOSTIC MICROBIOLOGY, FOURTEENTH EDITION

ISBN: 978-0-323-35482-0

Copyright © 2017 by Elsevier, Inc. All rights reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher. Details on how to seek permission, further information about the Publisher’s permissions policies and our arrangements with organizations such as the Copyright Clearance Center and the Copyright Licensing Agency, can be found at our website: www.elsevier.com/permissions. This book and the individual contributions contained in it are protected under copyright by the Publisher (other than as may be noted herein).

Notices Knowledge and best practice in this field are constantly changing. As new research and experience broaden our understanding, changes in research methods, professional practices, or medical treatment may become necessary. Practitioners and researchers must always rely on their own experience and knowledge in evaluating and using any information, methods, compounds, or experiments described herein. In using such information or methods they should be mindful of their own safety and the safety of others, including parties for whom they have a professional responsibility. With respect to any drug or pharmaceutical products identified, readers are advised to check the most current information provided (i) on procedures featured or (ii) by the manufacturer of each product to be administered, to verify the recommended dose or formula, the method and duration of administration, and contraindications. It is the responsibility of practitioners, relying on their own experience and knowledge of their patients, to make diagnoses, to determine dosages and the best treatment for each individual patient, and to take all appropriate safety precautions. To the fullest extent of the law, neither the Publisher nor the authors, contributors, or editors, assume any liability for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from any use or operation of any methods, products, instructions, or ideas contained in the material herein. Previous editions copyrighted 2014, 2007, 2002, 1998, 1994, 1990, 1986, 1982, 1978, 1974, 1970, 1966, 1962. Library of Congress Cataloging-in-Publication Data Names: Tille, Patricia M., author. Title: Bailey & Scott’s diagnostic microbiology / Patricia M. Tille. Other titles: Bailey and Scott’s diagnostic microbiology | Diagnostic microbiology Description: Fourteenth edition. | St. Louis, Missouri : Elsevier, [2017] | Includes bibliographical references and index. Identifiers: LCCN 2016013977 | ISBN 9780323354820 (hardcover : alk. paper) Subjects: | MESH: Microbiological Techniques | Diagnostic Techniques and Procedures | Microbiological Phenomena Classification: LCC QR67 | NLM QW 25 | DDC 616.07—dc23 LC record available at http://lccn.loc. gov/2016013977

Content Strategist: Kellie White Content Development Manager: Jean Sims Fornango Content Development Specialist: Melissa Rawe Publishing Services Manager: Jeff Patterson Project Manager: Lisa A. P. Bushey Senior Designer: Miles Hitchen Printed in China Last digit is the print number:  9  8  7  6  5  4  3  2  1

Everything we do is supported by a strong network of family, friends, and professional colleagues. To that end, it is impossible to name everyone. I am very grateful for the quality of work that the contributors and reviewers have dedicated to this edition. I would personally like to thank my husband David; our children: Chrissy, Malissa, D.J., and Katie, along with their significant others. These individuals continue to watch me grow, watch me fall, and are always there to push me or pick me up. I would be amiss if I did not mention the six little “smiles” that bring daily joy to our lives: Aedan, Milan Jr., Julia, Maja, Jayce, and Riley. Lastly, no endeavor such as this would continue to evolve from one edition to the next without the insightful comments and input from numerous professional users and students. Thank you for your dedication, hard work, and humor. Just like a parent, all students and young professionals are an integral part of my daily experience, and, like a parent, no one expects to watch amazing young professionals grow, be successful, and then be taken from this world way too soon. This edition is dedicated to one such amazing young woman, who crossed my path and became a friend and an adopted member of my family. She excelled in microbiology and always put others before herself. We are forever grateful for having shared in her life. In loving memory: Katie Pieschke Tipton 1985–2014

Reviewers

Jimmy L. Boyd, MT(ASCP), MS/MHS Assistant Professor/Department Chair Arkansas State University – Beebe Beebe, Arkansas

Valerie Carson, MS

Instructor University of South Florida Tampa, Florida

Janice Conway-Klaassen, PhD, MT(ASCP), SM Program Director, Medical Laboratory Sciences University of Minnesota Minneapolis, Minnesota

Kathleen Fennema, BS, MT(ASCP)

Senior Medical Technician Infectious Diseases Diagnostic Laboratory University of Minnesota Medical Center Minneapolis, Minnesota

Kathleen C. Givens, MSA, MT(ASCP) Program Director, MLT Baker College Allen Park, Michigan

Linda J. Graeter, PhD, MT(ASCP) Associate Professor University of Cincinnati Cincinnati, Ohio

Alissa Lehto-Hoffman, MT(ASCP) Education and Training Coordinator Charge Technologist South Bend Medical Foundation Adjunct Professor Ivy Tech Community College South Bend, Indiana; Adjunct Professor Andrews University Berrien Springs, Michigan

Louise Millis, MS, MT(ASCP)

MLS Program Director and Associate Professor of Biology St. Cloud State University St. Cloud, Minnesota

Caterina Miraglia, DC, MLS(ASCP)CM Assistant Professor Medical Laboratory Science University of Massachusetts Dartmouth, Massachusetts

James March Mistler, PSM, MLS(ASCP)CM Full-Time Lecturer Medical Laboratory Science University of Massachusetts Dartmouth, Massachusetts

Michelle Moy, MAEd, MT(ASCP)SC

Clinical Coordinator/Instructor MLT/PBT Southwestern Community College Sylva, North Carolina

CLS Program Director School of Continuing and Professional Studies Institutes for Allied Health Loyola University – Chicago Chicago, Illinois

Michele G. Harms, MS, MT(ASCP)

Jody L. Provencher, MS, MT(ASCP)

Ernest Dale Hall, MAEd, BS, MT(ASCP)

Program Director WCA Hospital Medical Laboratory Science Program WCA Hospital School of Medical Technology Jamestown, New York

vi

MLT Program Coordinator Mercer County Community College West Windsor, New Jersey

Reviewers

Tania Puro, CLS, MS, MT(ASCP)

Jennifer J. Sanderson, MS, CTT1, MLS(ASCP)CM

Mathumathi Rajavel, PhD

Becky Shelby

Instructor Clinical Lab Science Program San Francisco State University San Francisco, California Associate Professor Morgan State University Baltimore, Maryland

Lori Richardson-Parr, MPH, MT(ASCP) Association of Public Health Laboratories Silver Spring, Maryland

Lean Healthcare Certified – University of Michigan Central Lab Automation Specialist Siemens Healthineers Deerfield, Illinois Instructor Medical Laboratory Science Brookline College Phoenix, Arizona

vii

Contributors

Hassan A. Aziz, PhD, MLS(ASCP)CM

Director and Associate Professor of Biomedical Science Acting Coordinator of Graduate Program College of Arts and Sciences Qatar University Doha, Qatar Chapter 34: Legionella Chapter 77: Quality in the Clinical Microbiology Laboratory Chapter 78: Infection Control

Janice Conway-Klaassen, PhD, MT(ASCP), SM

Program Director, Medical Laboratory Sciences University of Minnesota Minneapolis, Minnesota Chapter 46: Overview of the Methods and Strategies in Parasitology

Rita M. Heuertz, PhD, MT(ASCP)

Professor, Director of Departmental Research Department of Clinical Laboratory Science Doisy College of Health Sciences Saint Louis University St. Louis, Missouri Chapter 23: Chryseobacterium, Sphingobacterium, and Similar Organisms Chapter 42: Mycobacteria Chapter 43: Obligate Intracellular and Nonculturable Bacterial Agents Chapter 45: The Spirochetes Chapter 66: Antiviral Therapy, Susceptibility Testing, and Prevention Chapter 79: Sentinel Laboratory Response to Bioterrorism

Stephanie Jacobson, MS, MLS(ASCP)CM Instructor South Dakota State University Rapid City, South Dakota Chapter 19: Enterobacteriaceae

viii

Stacie Lansink, MS, MLS(ASCP)CM

Instructor South Dakota State University Brookings, South Dakota Chapter 31: Haemophilus Chapter 33: Campylobacter, Arcobacter, and Helicobacter Chapter 35: Brucella Chapter 37: Francisella Chapter 38: Streptobacillus moniliformis and Spirillum minus

Chris L. McGowin, PhD

Assistant Professor Department of Microbiology, Immunology, and Parasitology; and Internal Medicine – Infectious Diseases LSU Health Sciences Center – New Orleans New Orleans, Louisiana Chapter 8: Nucleic Acid–Based Analytic Methods for Microbial Identification and Characterization Chapter 13: Staphylococcus, Micrococcus, and Similar Organisms Chapter 44: Cell Wall-Deficient Bacteria: Mycoplasma and Ureaplasma Chapter 64: Overview of the Methods and Strategies in Virology Chapter 65: Viruses and Human Disease Chapter 78: Infection Control

Mary Beth Miele, PhD, MLS(ASCP)CM, RM (NRCM) Education Coordinator and Instructor Pathology and Laboratory Medicine Penn State Hershey Medical Center Hershey, Pennsylvania Chapter 10: Principles of Antimicrobial Action and Resistance Chapter 11: Laboratory Methods and Strategies for Antimicrobial Susceptibility Testing Chapter 21: Pseudomonas, Burkholderia, and Similar Organisms

Contributors

Rita Miller, EdD, MT(ASCP)

Program Director/Instructor Minnesota West Community & Technical College Luverne, Minnesota; Microbiologist Avera McKennan Hospital & University Health Center Sioux Falls, South Dakota Chapter 14: Streptococcus, Enterococcus, and Similar Organisms

Nicholas Moore, PhD, MS, MT(ASCP)

Assistant Professor Rush University Medical Center Chicago, Illinois Chapter 20: Acinetobacter, Stenotrophomonas, and Other Organisms Chapter 23: Chryseobacterium, Sphingobacterium, and Similar Organisms Chapter 39: Neisseria and Moraxella catarrhalis

Rodent E. Rohde, PhD, MS, SV, SM(ASCP), MB

Chair, Professor, and Associate Dean for Research Clinical Laboratory Science Program Texas State University San Marcos, Texas Chapter 8: Nucleic Acid–Based Analytic Methods for Microbial Identification and Characterization Chapter 13: Staphylococcus, Micrococcus, and Similar Organisms Chapter 44: Cell Wall-Deficient Bacteria: Mycoplasma and Ureaplasma Chapter 64: Overview of the Methods and Strategies in Virology Chapter 65: Viruses and Human Disease Chapter 78: Infection Control

Frank Scarano, PhD, MS, BA, AAS

Professor Medical Laboratory Science University of Massachusetts Dartmouth, Massachusetts Chapter 28: Eikenella corrodens and Similar Organisms Chapter 29: Pasteurella and Similar Organisms

Patricia M. Tille, PhD, BS, MT(ASCP), FACSc

Chairperson Microbiology Advisory Group International Federation of Biomedical Laboratory Science Program Director Medical Laboratory Science South Dakota State University Brookings, South Dakota

Shannon E. Weigum, PhD, MS, BA

Assistant Professor Texas State University San Marcos, Texas Chapter 8: Nucleic Acid–Based Analytic Methods for Microbial Identification and Characterization

Ancillary Material Assistance Joanna Ellis, MS, MT(ASCP)

Clinical Assistant Professor & Clinical Coordinator Clinical Laboratory Science Program Texas State University San Marcos, Texas

April Nelsen, MS, MLS(ASCP)CM Instructor Medical Laboratory Science South Dakota State University Brookings, South Dakota

ix

Preface

This, the fourteenth edition of Bailey and Scott’s Diagnostic Microbiology, is the second edition that I have had the great pleasure to edit and author with some amazing colleagues. The dynamics of infectious disease trends, along with the technical developments available for diagnosing, treating, and controlling these diseases, continues to present major challenges in the laboratory and medical care. In meeting these challenges, the primary goal for the fourteenth edition is to provide an updated and reliable reference text for practicing clinical microbiologists and technologists, while also presenting this information in a format that supports the educational efforts of all those responsible for preparing others for a career in diagnostic microbiology. The text retains the traditional information needed to develop a solid, basic understanding of diagnostic microbiology while integrating the dynamic expansion of molecular diagnostics and advanced techniques such as matrix assisted laser desorption time-of-flight mass spectrometry. We have kept the favorite features and made adjustments in response to important critical input from users of the text. The succinct presentation of each organism group’s key laboratory, clinical, epidemiologic, and therapeutic features in tables and figures has been kept and updated. Regarding content, the major changes reflect the changes that the discipline of diagnostic microbiology continues to experience. Also, although the grouping of organisms into sections according to key features (e.g., Gram reaction, catalase or oxidase reaction, growth on MacConkey) has remained, changes regarding the genera and species discussed in these sections have been made. These changes, along with changes

x

in organism nomenclature, were made to accurately reflect the changes that have occurred, and continue to occur, in bacterial taxonomy. Also, throughout the text, the content has been enhanced with new photographs and artistic drawings. Finally, although some classic methods for bacterial identification and characterization developed over the years (e.g., catalase, oxidase, Gram stain) still play a critical role in today’s laboratory, others have given way to commercial identification systems. We realize that in a textbook such as this, a balance is needed for practicing and teaching diagnostic microbiology; our selection of identification methods that received the most detailed attention may not always meet the needs of both groups. However, we have tried to be consistent in selecting those methods that reflect the most current and common practices of today’s clinical microbiology laboratories, along with those that present historical information required within an educational program. Finally, in terms of organization, the fourteenth edition is similar in many aspects to the thirteenth edition, but some changes have been made. Various instructor ancillaries, specifically geared for the fourteenth edition, are available on the Evolve website, including an expanded test bank, updated PowerPoints, additional complex case studies, and an electronic image collection. Student resources include a laboratory manual, review questions with answer key, and procedures. We sincerely hope that clinical microbiology practition­ ers and educators find Bailey and Scott’s Diagnostic Micro­ biology, fourteenth edition, to be a worthy and useful tool to support their professional activities.

Acknowledgments Frontmatter

I would like to acknowledge the help of my colleagues at Elsevier who guided me through this project: Lisa A. P. Bushey, Project Manager, and Melissa Rawe, Content Development Specialist. Patricia M. Tille

xi

Contents

Part I  Basic Medical Microbiology, 1 1

Microbial Taxonomy, 1 Classification, 2 Nomenclature, 2 Identification, 3

2

3

Bacterial Genetics, Metabolism, and Structure, 5 Bacterial Genetics, 5 Bacterial Metabolism, 17 Structure and Function of the Bacterial Cell, 20

Section 2 Approaches to Diagnosis of Infectious Diseases, 72 6

7

Host-Microorganism Interactions, 24

8

Nucleic Acid–Based Analytic Methods for Microbial Identification and Characterization, 113 Overview of Nucleic Acid–Based Methods, 114 Postamplification and Traditional Analysis, 135

9

Overview of Immunochemical Methods Used for Organism Detection, 144 Features of the Immune Response, 144 Production of Antibodies for Use in Laboratory Testing, 147 IgM Clinical Significance, 149 Separating IgM from IgG for Serologic Testing, 149 Principles of Immunochemical Methods Used for Organism Detection, 149

Section 1  Safety and Specimen Management, 42 4

Laboratory Safety, 42 Sterilization, Disinfection, and Decontamination, 42 Chemical Safety, 45 Fire Safety, 46 Electrical Safety, 46 Handling of Compressed Gases, 46 Biosafety, 47 Exposure Control Plan, 47 Employee Education and Orientation, 48 Disposal of Hazardous Waste, 48 Standard Precautions, 48 Engineering Controls, 49 Classification of Biologic Agents Based on Hazard, 52 Mailing Biohazardous Materials, 53

5

Specimen Management, 56 General Concepts for Specimen Collection and Handling, 56 Specimen Preservation, 57 Specimen Workup, 69 Expediting Results Reporting: Computerization, 70

xii

Traditional Cultivation and Identification, 86 Organism Identification, 86 Principles of Bacterial Cultivation, 86 Bacterial Cultivation, 96 Principles of Identification, 99 Principles of Phenotypic Identification Schemes, 106 Commercial Identification Systems and Automation, 111

The Encounter Between Host and Microorganism, 25 Microorganism Colonization of Host Surfaces, 27 Microorganism Entry, Invasion, and Dissemination, 30 Outcome and Prevention of Infectious Diseases, 39

Part II General Principles in Clinical Microbiology, 42

Role of Microscopy, 72 Bright-Field (Light) Microscopy, 72 Phase-Contrast Microscopy, 79 Fluorescent Microscopy, 80 Dark-Field Microscopy, 83 Electron Microscopy, 84 Digital Automated Microscopy, 85

Section 3 Evaluation of Antimicrobial Activity, 161 10 Principles of Antimicrobial Action and Resistance, 161 Antimicrobial Action, 161 Mechanisms of Antibiotic Resistance, 169

Contents

11 Laboratory Methods and Strategies for Antimicrobial Susceptibility Testing, 177 Goal and Limitations, 177 Testing Methods, 178 Laboratory Strategies for Antimicrobial Susceptibility Testing, 197 Accuracy, 199 Communication, 203

Part III  Bacteriology, 205 Section 1  Principles of Identification, 205 12 Overview of Bacterial Identification Methods and Strategies, 205 Rationale for Approaching Organism Identification, 205 Future Trends of Organism Identification, 206

Section 2  Catalase-Positive, Gram-Positive Cocci, 248 13 Staphylococcus, Micrococcus, and Similar Organisms, 248 General Characteristics, 248 Epidemiology, 249 Pathogenesis and Spectrum of Disease, 249 Laboratory Diagnosis, 252 Antimicrobial Susceptibility Testing and Therapy, 259 Prevention, 261

Section 3  Catalase-Negative, Gram-Positive Cocci, 264 14 Streptococcus, Enterococcus, and Similar Organisms, 264 General Characteristics, 265 Epidemiology, 265 Pathogenesis and Spectrum of Disease, 266 Laboratory Diagnosis, 270 Antimicrobial Susceptibility Testing and Therapy, 279 Prevention, 281

Section 4 Non-Branching, Catalase-Positive, Gram-Positive Bacilli, 283 15 Bacillus and Similar Organisms, 283 General Characteristics, 283 Laboratory Diagnosis, 287 Antimicrobial Susceptibility Testing and Therapy, 290 Prevention, 292 16 Listeria, Corynebacterium, and Similar Organisms, 294 General Characteristics, 294 Epidemiology, 294 Pathogenesis and Spectrum of Disease, 296 Laboratory Diagnosis, 298 Antimicrobial Susceptibility Testing and Therapy, 304 Prevention, 307 Treatment, 307

Section 5 Non-Branching, Catalase-Negative, Gram-Positive Bacilli, 309 17 Erysipelothrix, Lactobacillus, and Similar Organisms, 309 General Characteristics, 309 Epidemiology, 309 Pathogenesis and Spectrum of Disease, 309 Laboratory Diagnosis, 311 Antimicrobial Susceptibility Testing and Therapy, 315 Prevention, 315

Section 6 Branching or Partially Acid-Fast, Gram-Positive Bacilli, 318 18 Nocardia, Streptomyces, Rhodococcus, and Similar Organisms, 318 General Characteristics, 319 Epidemiology and Pathogenesis, 319 Spectrum of Disease, 321 Laboratory Diagnosis, 322 Antimicrobial Susceptibility Testing and Therapy, 326 Prevention, 326

Section 7 Gram-Negative Bacilli and Coccobacilli (MacConkey-Positive, Oxidase-Negative), 329 19 Enterobacteriaceae, 329 General Characteristics, 330 Epidemiology, 330 Pathogenesis and Spectrum of Diseases, 332 Specific Organisms, 332 Laboratory Diagnosis, 338 Antimicrobial Susceptibility Testing and Therapy, 351 Prevention, 354 20 Acinetobacter, Stenotrophomonas, and Other Organisms, 357 General Characteristics, 357 Epidemiology, 357 Pathogenesis and Spectrum of Disease, 358 Laboratory Diagnosis, 359 Antimicrobial Resistance and Antimicrobial Susceptibility Testing, 362 Antimicrobial Therapy, 363 Prevention, 363

Section 8 Gram-Negative Bacilli and Coccobacilli (MacConkey-Positive, OxidasePositive), 365 21 Pseudomonas, Burkholderia, and Similar Organisms, 365 General Characteristics, 365 Epidemiology, 366 Pathogenesis and Spectrum of Disease, 367 Laboratory Diagnosis, 369

xiii

xiv

Contents

Antimicrobial Susceptibility Testing and Therapy, 375 Prevention, 375

22 Achromobacter, Rhizobium, Ochrobactrum, and Similar Organisms, 379 General Characteristics, 379 Epidemiology, 379 Pathogenesis and Spectrum of Disease, 379 Laboratory Diagnosis, 381 Antimicrobial Susceptibility Testing and Therapy, 383 Prevention, 383 23 Chryseobacterium, Sphingobacterium, and Similar Organisms, 385 General Characteristics, 385 Epidemiology, 385 Pathogenesis and Spectrum of Disease, 386 Laboratory Diagnosis, 386 Antimicrobial Susceptibility Testing and Therapy, 388 Prevention, 389 24 Alcaligenes, Bordetella (Nonpertussis), Comamonas, and Similar Organisms, 391 General Characteristics, 391 Epidemiology, 392 Pathogenesis and Spectrum of Disease, 392 Laboratory Diagnosis, 394 Antimicrobial Susceptibility Testing and Therapy, 396 Prevention, 398 25 Vibrio, Aeromonas, and Similar Organisms, 399 General Characteristics, 399 Epidemiology, 399 Pathogenesis and Spectrum of Disease, 400 Laboratory Diagnosis, 402 Antimicrobial Susceptibility Testing and Therapy, 406 Prevention, 406

Section 9 Gram-Negative Bacilli and Coccobacilli (MacConkey-Negative, Oxidase-Positive), 408 26 Sphingomonas paucimobilis and Similar Organisms, 408 General Considerations, 408 Epidemiology, Spectrum of Disease, and Antimicrobial Therapy, 408 Laboratory Diagnosis, 408 Prevention, 413 27 Moraxella, 415 General Characteristics, 415 Epidemiology, Spectrum of Disease, and Antimicrobial Therapy, 415 Laboratory Diagnosis, 416 Prevention, 418

28 Eikenella corrodens and Similar Organisms, 420 General Characteristics, 420 Epidemiology, Spectrum of Disease, and Antimicrobial Therapy, 420 Laboratory Diagnosis, 421 Serodiagnosis, 423 Prevention, 423 29 Pasteurella and Similar Organisms, 425 General Characteristics and Taxonomy, 425 Epidemiology, Spectrum of Disease, and Antimicrobial Therapy, 425 Laboratory Diagnosis, 426 Serodiagnosis, 429 Prevention, 429 30 Actinobacillus, Kingella, Cardiobacterium, Capnocytophaga, and Similar Organisms, 430 General Characteristics, 430 Epidemiology, Pathogenesis, and Spectrum of Disease and Antimicrobial Therapy, 431 Laboratory Diagnosis, 433 Serodiagnosis, 436 Prevention, 436

Section 10 Gram-Negative Bacilli and Coccobacilli (MacConkey-Negative, OxidaseVariable), 438 31 Haemophilus, 438 General Characteristics, 438 Epidemiology, 438 Pathogenesis and Spectrum of Disease, 438 Laboratory Diagnosis, 440 Antimicrobial Susceptibility Testing and Therapy, 443 Prevention, 445

Section 11 Gram-Negative Bacilli that are Optimally Recovered on Special Media, 446 32 Bartonella and Afipia, 446 Bartonella, 446 Afipia felis, 450 33 Campylobacter, Arcobacter, and Helicobacter, 452 Campylobacter and Arcobacter, 452 Helicobacter spp., 457 34 Legionella, 462 General Characteristics, 462 Pathogenesis and Spectrum of Disease, 462 Laboratory Diagnosis, 465 Antimicrobial Susceptibility Testing and Therapy, 467 Prevention, 467

Contents

35 Brucella, 470 General Characteristics, 470 Epidemiology and Pathogenesis, 470 Spectrum of Disease, 471 Laboratory Diagnosis, 471 Antimicrobial Susceptibility Testing and Therapy, 473 Prevention, 473 36 Bordetella pertussis, Bordetella parapertussis, and Related Species, 475 General Characteristics, 475 Spectrum of Disease, 476 Laboratory Diagnosis, 477 Antimicrobial Susceptibility Testing and Therapy, 479 Prevention, 479 37 Francisella, 480 General Characteristics, 480 Epidemiology and Pathogenesis, 480 Spectrum of Disease, 481 Laboratory Diagnosis, 481 Antimicrobial Susceptibility Testing and Therapy, 483 Prevention, 483 38 Streptobacillus moniliformis and Spirillum minus, 485 Streptobacillus moniliformis, 485 Spirillum minus, 487

Section 12  Gram-Negative Cocci, 489 39 Neisseria and Moraxella catarrhalis, 489 General Characteristics, 489 Epidemiology, 489 Pathogenesis and Spectrum of Disease, 490 Laboratory Diagnosis, 490 Antimicrobial Susceptibility Testing and Therapy, 496 Prevention, 497

Section 13  Anaerobic Bacteriology, 499 40 Overview and General Laboratory Considerations, 499 General Characteristics, 499 Specimen Collection and Transport, 499 Macroscopic Examination of Specimens, 500 Direct Detection Methods, 500 Specimen Processing, 504 Anaerobic Media, 505 Approach to Identification, 506 Antimicrobial Susceptibility Testing and Therapy, 509 41 Overview of Anaerobic Organisms, 513 Epidemiology, 514 Pathogenesis and Spectrum of Disease, 514 Prevention, 523

Section 14 Mycobacteria and Other Bacteria with Unusual Growth Requirements, 524 42 Mycobacteria, 524 Mycobacterium tuberculosis Complex, 525 Nontuberculous Mycobacteria, 528 Laboratory Diagnosis of Mycobacterial Infections, 534 Antimicrobial Susceptibility Testing and Therapy, 550 Prevention, 552 43 Obligate Intracellular and Nonculturable Bacterial Agents, 555 Chlamydia, 555 Rickettsia, Orientia, Anaplasma, and Ehrlichia, 563 Coxiella, 566 Tropheryma whipplei, 566 Klebsiella granulomatis, 567 44 Cell Wall-Deficient Bacteria: Mycoplasma and Ureaplasma, 570 General Characteristics, 570 Epidemiology and Pathogenesis, 570 Spectrum of Disease, 572 Laboratory Diagnosis, 572 Cultivation, 574 Susceptibility Testing and Therapy, 576 Prevention, 577 45 The Spirochetes, 578 Treponema, 578 Borrelia, 583 Brachyspira, 586 Leptospira, 587 Prevention, 588

Part IV  Parasitology, 590 46 Overview of the Methods and Strategies in Parasitology, 590 Epidemiology, 590 Pathogenesis and Spectrum of Disease, 593 Laboratory Diagnosis, 601 Approach to Identification, 606 Prevention, 627 47 Intestinal Protozoa, 629 Amoebae, 629 Flagellates, 649 Ciliates, 656 Sporozoa (Apicomplexa), 657 Microsporidia, 665 48 Blood and Tissue Protozoa, 670 Plasmodium spp., 670 Babesia spp., 682 Trypanosoma spp., 683 Leishmania spp., 687

xv

xvi

Contents

49 Protozoa from Other Body Sites, 691 Free-Living Amoebae, 691 Naegleria fowleri, 691 Acanthamoeba spp., 695 Acanthamoeba Keratitis, 696 Balamuthia mandrillaris, 696 Trichomonas vaginalis, 697 Pentatrichomonas hominis, 699 Toxoplasma gondii, 699 50 Intestinal Nematodes, 703 Ascaris lumbricoides, 703 Enterobius vermicularis, 705 Strongyloides stercoralis, 707 Trichostrongylus spp., 709 Trichuris trichiura, 709 Capillaria philippinensis, 710 Hookworms, 711 Ancylostoma duodenale, 711 Necator americanus, 712 Results and Reporting, 713 51 Tissue Nematodes, 714 Trichinella spiralis, 714 Toxocara canis (Visceral Larva Migrans) and Toxocara cati (Ocular Larva Migrans), 715 Ancylostoma braziliense or Ancylostoma caninum (Cutaneous Larva Migrans), 716 Dracunculus medinensis, 717 Parastrongylus cantonensis (Cerebral Angiostrongyliasis), 718 Parastrongylus costaricensis (Abdominal Angiostrongyliasis), 719 Gnathostoma spinigerum, 719 Dirofilaria immitis and Other Species, 719 52 Blood Nematodes, 721 Wuchereria bancrofti, 721 Brugia malayi and Brugia timori, 723 Loa loa, 724 Onchocerca volvulus, 725 Mansonella spp. (M. ozzardi, M. streptocerca, M. perstans), 726 53 Intestinal Cestodes, 728 Diphyllobothrium latum, 728 Dipylidium caninum, 733 Hymenolepis nana, 733 Hymenolepis diminuta, 735 Taenia solium, 736 Taenia saginata, 737 54 Tissue Cestodes, 739 Taenia solium, 739 Echinococcus granulosus, 740 Echinococcus multilocularis, 742 Taenia multiceps and Other Species, 743 Spirometra mansonoides, 743

55 Intestinal Trematodes, 745 Fasciolopsis buski, 745 Heterophyes and Metagonimus yokogawai, 746 56 Liver and Lung Trematodes, 748 The Liver Flukes, 748 The Lung Flukes, 750 57 Blood Trematodes, 753 General Characteristics, 753 Epidemiology, 754 Pathology and Spectrum of Disease, 755 Laboratory Diagnosis, 755 Therapy, 756 Prevention, 756

Part V  Mycology, 757 58 Overview of Fungal Identification Methods and Strategies, 757 Epidemiology, 758 General Features of the Fungi, 758 Taxonomy of the Fungi, 758 Clinical Classification of the Fungi, 759 Pathogenesis and Spectrum of Disease, 762 Laboratory Diagnosis, 762 General Considerations for the Identification of Yeasts, 771 General Considerations for the Identification of Molds, 772 General Morphologic Features of the Molds, 774 Clinical Relevance for Fungal Identification, 776 Laboratory Safety, 779 Prevention, 780 59 Hyaline Molds, Mucorales, Entomophthorales, Dermatophytes, and Opportunistic and Systemic Mycoses, 782 The Mucorales, 782 The Entomophthorales, 786 The Dermatophytes, 787 The Opportunistic Mycoses, 793 Systemic Mycoses, 798 60 Dematiaceious (Melanized) Molds, 812 General Characteristics, 812 Epidemiology and Pathogenesis, 812 Pathogenesis and Spectrum of Disease, 813 Laboratory Diagnosis, 815 61 Opportunistic Atypical Fungus: Pneumocystis jirovecii, 822 General Characteristics, 822 Epidemiology, 822 Pathogenesis and Spectrum of Disease, 822 Laboratory Diagnosis, 823

Contents

62 The Yeasts, 825 General Characteristics, 825 Epidemiology, 826 Pathogenesis and Spectrum of Disease, 827 Laboratory Diagnosis, 830 Commercially Available Yeast Identification Systems, 835 Conventional Yeast Identification Methods, 836 63 Antifungal Susceptibility Testing, Therapy, and Prevention, 840 Antifungal Susceptibility Testing, 840 Antifungal Therapy and Prevention, 841

Part VI  Virology, 844 64 Overview of the Methods and Strategies in Virology, 844 General Characteristics, 845 Epidemiology, 848 Pathogenesis and Spectrum of Disease, 848 Prevention and Therapy, 849 Viruses That Cause Human Diseases, 849 Laboratory Diagnosis, 849 65 Viruses in Human Disease, 881 Viruses in Human Disease, 881 Adenoviruses, 881 Arenaviruses, 883 Bunyaviruses, 884 Caliciviruses, 885 Coronaviruses, 886 Filoviruses, 887 Flaviviruses, 888 Hepevirus, 890 Hepadnaviruses, 891 Herpes Viruses, 892 Orthomyxoviruses, 897 Papillomaviruses, 899 Paramyxoviruses, 900 Parvoviruses, 902 Picornaviruses, 903 Polyomaviruses, 905 Poxviruses, 906 Reoviruses, 907 Retroviruses, 908 Rhabdoviruses, 910 Togaviruses, 911 Miscellaneous Viruses, 911 Interpretation of Laboratory Test Results, 911 Prions in Human Disease, 913 66 Antiviral Therapy, Susceptibility Testing, and Prevention, 916 Antiviral Therapy, 916 Antiviral Resistance, 916 Methods of Antiviral Susceptibility Testing, 917 Prevention of Other Viral Infections, 920

Part VII  Diagnosis by Organ System, 924 67 Bloodstream Infections, 924 General Considerations, 925 Detection of Bacteremia, 931 Special Considerations for Other Relevant Organisms Isolated from Blood, 938 68 Infections of the Lower Respiratory Tract, 942 General Considerations, 942 Diseases of the Lower Respiratory Tract, 945 Laboratory Diagnosis of Lower Respiratory Tract Infections, 950 69 Upper Respiratory Tract Infections and Other Infections of the Oral Cavity and Neck, 957 General Considerations, 957 Diseases of the Upper Respiratory Tract, Oral Cavity, and Neck, 957 Diagnosis of Upper Respiratory Tract Infections, 961 Diagnosis of Infections in the Oral Cavity and Neck, 963 70 Meningitis and Other Infections of the Central Nervous System, 965 General Considerations, 965 Shunt Infections, 970 Laboratory Diagnosis of Central Nervous System Infections, 971 71 Infections of the Eyes, Ears, and Sinuses, 976 Eyes, 976 Ears, 983 Sinuses, 984 72 Infections of the Urinary Tract, 987 General Considerations, 987 Infections of the Urinary Tract, 988 Laboratory Diagnosis of Urinary Tract Infections, 992 73 Genital Tract Infections, 999 General Considerations, 999 Genital Tract Infections, 1001 Laboratory Diagnosis of Genital Tract Infections, 1007 74 Gastrointestinal Tract Infections, 1015 Anatomy, 1015 Resident Gastrointestinal Microbiome, 1017 Gastroenteritis, 1017 Other Infections of the Gastrointestinal Tract, 1025 Laboratory Diagnosis of Gastrointestinal Tract Infections, 1028 75 Skin, Soft Tissue, and Wound Infections, 1034 General Considerations, 1034 Skin and Soft Tissue Infections, 1035 Laboratory Diagnostic Procedures, 1042

xvii

xviii

Contents

76 Normally Sterile Body Fluids, Bone and Bone Marrow, and Solid Tissues, 1046 Specimens from Sterile Body Sites, 1046 Laboratory Diagnostic Procedures, 1051

Part VIII Clinical Laboratory Management, 1055 77 Quality in the Clinical Microbiology Laboratory, 1055 Quality Program, 1056 Specimen Collection and Transport, 1056 Standard Operating Procedure Manual, 1057 Personnel, 1057 Reference Laboratories, 1057 Patient Reports, 1057 Proficiency Testing, 1057 Performance Checks, 1058 Antimicrobial Susceptibility Tests, 1058 Maintenance of Quality Control Records, 1059 Maintenance of Reference Quality Control Stocks, 1059 Quality Assurance Program, 1060

Types of Quality Assurance Audits, 1060 Conducting a Quality Assurance Audit, 1061 Continuous Daily Monitoring, 1061

78 Infection Control, 1063 Incidence of Health Care–Associated Infections, 1064 Types of Health Care–Associated Infections, 1064 Emergence of Antibiotic-Resistant Microorganisms, 1065 Hospital Infection Control Programs, 1065 Role of the Microbiology Laboratory, 1066 Characterizing Strains Involved in an Outbreak, 1066 Preventing Health Care–Associated Infections, 1068 Surveillance Methods, 1070 79 Sentinel Laboratory Response to Bioterrorism, 1072 General Considerations, 1072 Government Laws and Regulations, 1072 Laboratory Response Network, 1073 Glossary, 1077 Index, 1084

PART I  Basic Medical Microbiology

1

Microbial Taxonomy

OBJECTIVES 1. Define classification, identification, species, genus, and binomial nomenclature. 2. Properly use binomial nomenclature in the identification of microorganisms, including syntax, capitalization, and punctuation. 3. Identify a microorganism’s characteristics as either phenotypic or genotypic. 4. Describe how the classification, naming, and identification of organisms play a role in diagnostic microbiology in the clinical setting.

T

axonomy is an area of biologic science that comprises three distinct but highly interrelated disciplines: classification, nomenclature (naming), and identification of organisms. Applied to all living entities, taxonomy provides a consistent means to classify, name, and identify organisms. This consistency allows biologists worldwide to use a common label for every organism studied within the multitude of biologic disciplines. The common language that taxonomy provides minimizes confusion about names, allowing more attention to be focused on other important scientific issues and phenomena. Taxonomy is important not only in phylogeny (the evolutionary history of organisms), but also in virtually every other biologic discipline, including microbiology. As a result of the advances in molecular biology, classic taxonomy has now become what is referred to as polyphasic taxonomy. This method of classification combines the traditional genotypic, phenotypic, and phylogenetic or evolutionary relationships into a general purpose classification system. At the molecular level this process is multifaceted, using ribosomal ribonucleic acid (rRNA) sequences, whole genome sequences, and epigenetic (variations not caused by nucleic acid sequence similarities or differences) factors. The polyphasic taxonomic approach provides a more detailed but very complex analysis of the current classification system. Not all parameters clearly delineate each organism to the species level. In other words, some characteristics may strengthen the organization of the genus, and some may be useful at the species level. Species identification can be based on such techniques as deoxyribonucleic acid (DNA)– DNA hybridization (DDH) of 50% to 70% relatedness or

comparative analysis of conserved sequences such as the 16s rDNA (95% to 97%). Both techniques have limitations that include variation in cutoff values between different species or genera. When using a single sequence such as the 16s rDNA, the possibility of gene transfer may also affect genotypic classification. Finally, lateral gene transfer among organisms, particularly bacteria, creates difficulty in the classification of organisms according to phenotypic traits or biochemical traits and genotypic criteria such as DNA G 1 C content, which is the hallmark of diagnostic microbiology. Molecular methods have provided a means for identifying the historical core genomes used in classification and species identification. But it is important to recognize that phenotypic expression and classification of organisms will continue to be compounded by the variation in genomes as a result of lateral gene transfer among organisms. In addition to more advanced genomic analysis, chemotaxonomic methods are more frequently being applied to the identification and classification of microorganisms. These methods include protein studies, fatty acid analysis, and cell wall composition. Mass spectrometry and more recently matrix-assisted laser desorption ionization timeof-flight mass spectrometry (MALDI-TOF MS) use the separation and analysis of high-abundance peptides for the classification and identification of bacterial isolates. More advanced techniques such as surface-enhanced laser desorption ionization time-of-flight mass spectrometry uses a protein array chip that captures proteins directly without the loss of sample and decreased sensitivity that is evident in MALDI-TOF MS. Finally, new biosensor technology (Bruker Daltonics, Inc., Billerica, MA) uses a multiplex pool of polymerase chain reaction (PCR) primers that target the conserved sequences in bacterial genomes coupled with high-precision electrospray ionization mass spectrometry to identify and group organisms. The polyphasic approach is intended to use the data from MALDI-TOF MS in conjunction with the genomic analysis and phenotypic characteristics to identify and classify organisms. As technology improves, the classification and identification of organisms will undoubtedly continue to evolve along with the changes in the populations of organisms. In diagnostic microbiology, classification, nomenclature, and identification of microorganisms play a central role in providing an accurate and timely diagnosis of infectious 1

2 PA RT I  Basic Medical Microbiology

disease. A brief, detailed discussion of the major components of taxonomy is important for a basic understanding of bacterial identification and application to diagnostic microbiology.

Classification Classification is a method for organizing microorganisms into groups or taxa based on similar morphologic, physiologic, and genetic traits. The hierarchical classification system consists of the following taxa designations: • Domains (Bacteria, Archaea, and Eukarya) • Kingdom (contains similar divisions or phyla; most inclusive taxa) • Phylum (contains similar classes; equivalent to the Division taxa in botany) • Class (contains similar orders) • Order (contains similar families) • Family (contains similar genera) • Genus (contains similar species) • Species (specific epithet; lowercase Latin adjective or noun; most exclusive taxa) Historically, bacteria or prokaryotes (prenucleus) were included in a single domain. However, with the more detailed analysis using modern techniques, this domain has now been separated into the Bacteria and the Archaea (ancient bacteria). The Bacteria contain the environmental prokaryotes (blue green or cyanobacteria) and the heterotrophic medically relevant bacteria. The Archaea are environmental isolates that live in extreme environments such as high salt concentrations, jet fuel, or extreme temperatures. The third domain, Eukarya, eukaryotes (true nucleus), also contains medically relevant organisms, including fungi and parasites. There are several other taxonomic sublevels below the domains, as noted previously; however the typical application of organism classification in the diagnostic microbiology laboratory primarily uses the taxa beginning at the family designation.

Family A family encompasses a group of organisms that may contain multiple genera and consists of organisms with a common attribute. The name of a family is formed by adding the suffix -aceae to the root name of one of the group’s genera, called the type genus; for example, the Streptococcaceae family type genus is Streptococcus. One exception to the rule in microbiology is the family Enterobacteriaceae; it is named after the “enteric” group of bacteria rather than the type species Escherichia coli. Bacterial (prokaryotic)-type species or strains are determined according to guidelines published by the International Committee for the Systematics of Prokaryotes. Species definitions are distinguished using DNA profiling, including a nearly complete 16S rRNA sequence with less than 0% to 5% ambiguity in combination with phenotypic traits. Type species should also be described in detail using diagnostic and comparable methods that are reproducible.

Genus Genus (plural, genera), the next taxon, contains different species that have several important features in common. Each species within a genus differs sufficiently to maintain its status as an individual species. Placement of a species within a particular genus is based on various genetic and phenotypic characteristics shared among the species. Microorganisms do not possess the multitude of physical features exhibited by higher organisms such as plants and animals. For instance, they rarely leave any fossil record, and they exhibit a tremendous capacity to intermix genetic material among seemingly unrelated species and genera. For these reasons, confidently establishing a microorganism’s relatedness in higher taxa beyond the genus level is difficult. Although grouping similar genera into common families and similar families into common orders is used for classification of plants and animals, these higher taxa designations (i.e., division, class, and order) are not useful for classifying bacteria.

Species Species (abbreviated as sp., singular, or spp., plural) is the most basic of the taxonomic groups and can be defined as a collection of bacterial strains that share common physiologic and genetic features and differ notably from other microbial species. Occasionally, taxonomic subgroups within a species, called subspecies, are recognized. Furthermore, designations such as biotype, serotype, or genotype may be given to groups below the subspecies level that share specific but relatively minor characteristics. For example, Klebsiella pneumoniae and Klebsiella oxytoca are two distinct species within the genus Klebsiella. Serratia odorifera biotype 2 and Treponema pallidum subsp. pallidum are examples of a biotype and a subspecies designation. A biotype is considered the same species with the same genetic makeup but displays differential physiologic characteristics. Subspecies do not display significant enough divergence to be classified as a biotype or a new species. Although these subgroups may have some taxonomic importance, their usefulness in diagnostic microbiology is limited.

Nomenclature Nomenclature is the naming of microorganisms according to established rules and guidelines set forth in the International Code of Nomenclature of Bacteria (ICNB) or the Bacteriological Code (BC). It provides the accepted labels by which organisms are universally recognized. Because genus and species are the groups commonly used by microbiologists, the discussion of rules governing microbial nomenclature is limited to these two taxa. In this binomial (two name) system of nomenclature, every organism is assigned a genus and a species of Latin or Greek derivation. Each organism has a scientific “label” consisting of two parts: the genus designation, in which the first letter is always capitalized, and the species designation, in which the first letter is always lowercase. The two components are used simultaneously and are printed

CHAPTER 1  Microbial Taxonomy

in italics or underlined in script. For example, the streptococci include Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus agalactiae, and Streptococcus bovis, among others. Alternatively, the name may be abbreviated by using the uppercase form of the first letter of the genus designation followed by a period (.) and the full species name, which is never abbreviated (e.g., S. pneumoniae, S. pyogenes, S. agalactiae, and S. bovis). Frequently an informal designation (e.g., staphylococci, streptococci, enterococci) may be used to label a particular group of organisms. These designations are not capitalized or italicized. As more information is gained regarding organism classification and identification, a particular species may be moved to a different genus or assigned a new genus name. The rules and criteria for these changes are beyond the scope of this chapter, but such changes are documented in the International Journal of Systemic and Evolutionary Microbiology. Published nomenclature may be found at http://www.bacterio.net for bacteria, http://www.ictvonline.org for viruses, http://www.iapt-taxon. org/nomen/main.php for fungi, and http://www.iczn.org for parasites. It is important to note that the fungi and parasite lists are difficult to maintain and may not reflect the current validity at the time of review. In the diagnostic laboratory, changes in nomenclature are phased in gradually so that physicians and laboratorians have ample opportunity to recognize that a familiar pathogen has been given a new name. This is usually accomplished by using the new genus designation while continuing to provide the previous designation in parentheses; for example, Stenotrophomonas (Xanthomonas) maltophilia or Burkholderia (Pseudomonas) cepacia.

Identification Microbial identification is the process by which a microorganism’s key features are delineated. Once those features have been established, the profile is compared with those of other previously characterized microorganisms. The organism can then be assigned to the most appropriate taxa (classification) and can be given appropriate genus and species names (nomenclature); both are essential aspects of the role of taxonomy in diagnostic microbiology and the management of infectious disease (Box 1-1).

Identification Methods A wide variety of methods and criteria are used to establish a microorganism’s identity. These methods usually can be separated into either of two general categories: genotypic or phenotypic characteristics. Genotypic characteristics relate to an organism’s genetic makeup, including the nature of the organism’s genes and constituent nucleic acids (see Chapter 2 for more information about microbial genetics). Phenotypic characteristics are based on features beyond the genetic level, including both readily observable characteristics and features that may require extensive analytic procedures to be detected. Examples of characteristics used as criteria for bacterial identification and classification are

• BOX 1-1

3

Role of Taxonomy in Diagnostic Microbiology

• Establishes and maintains records of key characteristics of clinically relevant microorganisms • Facilitates communication among technologists, microbiologists, physicians, and scientists by assigning universal names to clinically relevant microorganisms. This is essential for: • Establishing an association of particular diseases or syndromes with specific microorganisms • Epidemiology and tracking outbreaks • Accumulating knowledge regarding the management and outcome of diseases associated with specific microorganisms • Establishing patterns of resistance to antimicrobial agents and recognition of changing microbial resistance patterns • Understanding the mechanisms of antimicrobial resistance and detecting new resistance mechanisms exhibited by microorganisms • Recognizing new and emerging pathogenic microorganisms • Recognizing changes in the types of infections or diseases caused by characteristic microorganisms • Revising and updating available technologies for the development of new methods to optimize the detection and identification of infectious agents and the detection of resistance to antiinfective agents (microbial, viral, fungal, and parasitic) • Developing new antiinfective therapies (microbial, viral, fungal, and parasitic)

provided in Table 1-1. Modern microbial taxonomy uses a combination of several methods to characterize microorganisms thoroughly to classify and name each organism. Although the criteria and examples in Table 1-1 are given in the context of microbial identification for classification purposes, the principles and practices of classification parallel the approaches used in diagnostic microbiology for the identification and characterization of microorganisms encountered in the clinical setting. Fortunately, because of the previous efforts and accomplishments of microbial taxonomists, microbiologists do not have to use several burdensome classification and identification schemes to identify infectious agents. Instead, microbiologists use key phenotypic and genotypic features on which to base their identification to provide clinically relevant information in a timely manner (see Chapter 12). This should not be taken to mean that the identification of all clinically relevant organisms is easy and straightforward. This is also not meant to imply that microbiologists can only identify or recognize organisms that have already been characterized and named by taxonomists. Indeed, the clinical microbiology laboratory is well recognized as the place where previously unknown or uncharacterized infectious agents are initially encountered, and as such it has an ever-increasing responsibility to be the source of information and reporting for emerging etiologies of infectious disease. Visit the Evolve site for a complete list of procedures, review questions, and case study answers.

4 PA RT I  Basic Medical Microbiology

TABLE Identification Criteria and Characteristics for Microbial Classification 1-1

Criteria

Characteristics

Phenotypic Macroscopic morphology

The microbial growth patterns on artificial media as observed when inspected with the unaided eye. Examples include the size, texture, and pigmentation of bacterial colonies.

Microscopic morphology

The size, shape, intracellular inclusions, cellular appendages, and arrangement of cells when observed with the aid of microscopic magnification.

Staining characteristics

The ability of an organism to reproducibly stain a particular color with the application of specific dyes and reagents. Staining is used in conjunction with microscopic morphology for bacterial identification. For example, the Gram stain for bacteria is a critical criterion for differential identification.

Environmental requirements

The ability of an organism to grow at various temperatures, in the presence of oxygen and other gases, at various pH levels, or in the presence of other ions and salts, such as NaCl.

Nutritional requirements

The ability of an organism to utilize various carbon and nitrogen sources as nutritional substrates when grown under specific environmental conditions.

Resistance profiles

The exhibition of a characteristic inherent resistance to specific antibiotics, heavy metals, or toxins.

Antigenic properties

The profiles of microorganisms established by various serologic and immunologic methods to determine relatedness among various microbial groups.

Subcellular properties

Molecular constituents of the cell that are typical of a particular taxon, or organism group, as established by various analytic methods. Some examples include cell wall components, components of the cell membrane, and enzymatic content of the microbial cell.

Chemotaxonomic properties

The chemical constituents of the cell, such as the structure of teichoic acids, fatty acid analysis, and protein profiles, as determined by analytical methods.

Genotypic Deoxyribonucleic acid (DNA) base composition ratio

DNA comprises four bases (guanine, cytosine, adenine, and thymine). The extent to which the DNA from two organisms is made up of cytosine and guanine (i.e., G 1 C content) relative to their total base content can be used as an indicator of relatedness or lack thereof. For example, an organism with a G 1 C content of 50% is not closely related to an organism with a G 1 C content of 25%.

Nucleic acid (DNA and ribonucleic acid [RNA]) base sequence characteristics, including those determined by hybridization assays

The order of bases along a strand of DNA or RNA is known as the base sequence. The extent to which sequences are homologous (similar) between two microorganisms can be determined directly or indirectly by various molecular methods. The degree of similarity in the sequences may be a measure of the degree of organism relatedness, specifically, the ribosomal RNA (rRNA) sequences that remain stable in comparison to the genome as a whole.

Bibliography Bennett J, Dolin R, Blaser M: Principles and practice of infectious diseases, ed 8, Philadelphia, 2015, Elsevier-Saunders. Bhandari V, Naushad HS, Gupta RS: Protein based molecular markers provide reliable means to understand prokaryotic phylogeny and support Darwinian mode of evolution, Front Cell Infect Microbiol 2:98, 2012. Brock TD, Madigan M, Martinko J, et al, editors: Biology of microorganisms, Englewood Cliffs, NJ, 2009, Prentice Hall. Clark AE, Kaleta EJ, Arora A, Wolk DM: Matrix-assisted laser desorption ionization time-of-flight mass spectrometry: a fundamental

shift in the routine practice of clinical microbiology, Clin Microbiol Rev 26:547-603, 2013. Dworkin M, Falkow S, Rosenberg E, et al, editors: The prokaryotes: a handbook on the biology of bacteria: ecophysiology, isolation, identification, applications, vol 1-4, New York, 2006, Springer. Garrity GM, editor: Bergey’s manual of systematic bacteriology, ed 2, New York, 2001, Springer. Jorgensen J, Pfaller M, Carroll K, et al: Manual of clinical microbiology, ed 11, Washington, DC, 2015, ASM Press. Stackebrandt E, Frederiksen W, Garrity GM, et al: Report on ad hoc committee for the re-evaluation of the species identification in bacteriology, Int J Syst Evol Microbiol 52:1043-1047, 2002.

2

Bacterial Genetics, Metabolism, and Structure OBJECTIVES 1. Describe the basic structure and organization of prokaryotic (bacterial) chromosomes, including number, relative size, and cellular location. 2. Outline the basic processes and essential components required for information transfer in replication, transcription, translation, and regulatory mechanisms. 3. Define mutation, recombination, transduction, transformation, and conjugation. 4. Describe how genetic alterations and diversity provide a mechanism for the evolution and survival of microorganisms. 5. Differentiate environmental oxygenation and final electron acceptors (aerobes, facultative anaerobes, and strict anaerobes) in the formation of energy. 6. Compare and contrast the key structural elements, cellular organization, and types of organisms classified as prokaryotic and eukaryotic. 7. State the functions and biologic significance of the following cellular structures: the outer membrane, cell wall, periplasmic space, cytoplasmic membrane, capsule, fimbriae, pili, flagella, nucleoid, and cytoplasm. 8. Differentiate the organization and chemical composition of the cell envelope for a gram-positive and a gramnegative bacterium.

M

icrobial genetics, metabolism, and structure are the keys to microbial viability and survival. These processes involve numerous pathways that are widely varied, often complicated, and frequently interactive. Essentially, survival requires nutrients and energy to fuel the synthesis of materials necessary to grow, propagate, and carry out other metabolic processes (Figure 2-1). Although the goal of survival is the same for all organisms, the strategies microorganisms use to accomplish this vary substantially. Knowledge regarding genetic, metabolic, and structural characteristics of microorganisms provides the basis for understanding almost every aspect of diagnostic microbiology, including: • The mechanism or mechanisms by which microorganisms cause disease • The development and implementation of techniques for microbial detection, cultivation, identification, and characterization

• Antimicrobial action and resistance • The development and implementation of tests for the detection of antimicrobial resistance • Potential strategies for disease therapy and control Microorganisms vary significantly in many genetic and therefore physiologic aspects. A detailed consideration of these differences is beyond the scope of this textbook. Therefore a generalized description of bacterial systems is used as a model to discuss microbial genetics, metabolism, and structure. Information regarding characteristics of fungi, parasites, and viruses can be found in subsequent chapters that discuss each specific taxonomic group.

Bacterial Genetics Genetics, the process of heredity and variation, is the starting point from which all other cellular pathways, functions, and structures originate. The ability of a microorganism to maintain viability, adapt, multiply, and cause disease is determined by the organism’s genetic composition. The three major aspects of microbial genetics that require discussion include: • The structure and organization of genetic material • Replication and expression of genetic information • The mechanisms by which genetic information is altered and exchanged among bacteria

Nucleic Acid Structure and Organization For all living entities, hereditary information resides or is encoded in nucleic acids. The two major classes of nucleic acids are deoxyribonucleic acid (DNA), which is the most common macromolecule that encodes genetic information, and ribonucleic acid (RNA). In some forms, RNA encodes genetic information for various viruses; in other forms, RNA plays an essential role in several of the genetic processes in prokaryotic and eukaryotic cells, including the regulation and transfer of information. Prokaryotic, or prenuclear, organisms do not have membrane-bound organelles, and the cells’ genetic material is therefore not enclosed in a nucleus. Eukaryotic, or “true nucleus,” organisms have the genetic material enclosed in a nuclear envelope. 5

6 PA RT I   Basic Medical Microbiology

Energy and nutrients

Motion and other responses to environment

Genetic processes Biosynthesis

Assembly of cell structure

Waste removal

Bacterial cell

• Figure 2-1  General overview of bacterial cellular processes.

Nucleotide Structure and Sequence DNA consists of deoxyribose sugars connected by phosphodiester bonds (Figure 2-2, A). The bases that are covalently linked to each deoxyribose sugar are the key to the genetic code within the DNA molecule. The four nitrogenous bases include two purines, adenine (A) and guanine (G), and the two pyrimidines, cytosine (C) and thymine (T) (Figure 2-3). In RNA, uracil replaces thymine. The combined sugar, phosphate, and a base form a single unit referred to as a nucleotide (adenosine triphosphate [ATP], guanine triphosphate [GTP], cytosine triphosphate [CTP], and thymine triphosphate [TTP] or uridine triphosphate [UTP]). DNA and RNA are nucleotide polymers (i.e., chains or strands), and the order of bases along a DNA or RNA strand is known as the base sequence. This sequence provides the information that codes for the proteins that will be synthesized by microbial cells; that is, the sequence is the genetic code.

DNA Molecular Structure The intact DNA molecule is composed of two nucleotide polymers. Each strand has a 59 (prime) phosphate and a 39 (prime) hydroxyl terminus (see Figure 2-2, A). The two strands run antiparallel, with the 59 of one strand opposed to the 39 terminal of the other. The strands are also complementary. This adherence to A-T and G-C base pairing results in a double-stranded DNA (dsDNA) molecule (double helix). The two single strands of DNA are oriented in an antiparallel configuration, resulting in a “twisted ladder” structure (Figure 2-2, B). In addition, the dedicated base pairs provide the essential format for consistent replication and expression of the genetic code. In contrast to DNA, which carries the genetic code, RNA rarely exists as a double-stranded molecule. There are four major types of RNA (messenger RNA [mRNA], transfer RNA [tRNA], and ribosomal RNA [rRNA]) along with a variety of noncoding RNA (ncRNA), molecules that play key roles in gene expression.

Genes and the Genetic Code A DNA sequence that encodes for a specific product (RNA or protein) is defined as a gene. Thousands of genes in an organism encode messages or blueprints for the production

of one or more proteins and RNA products that play essential metabolic roles in the cell. All the genes in an organism comprise the organism’s genome. The size of a gene and an entire genome is usually expressed in the number of base pairs (bp) present (e.g., kilobases [103 bases], megabases [106 bases]). Certain genes are widely distributed among various organisms, whereas others are limited to a particular species. Also, the base pair sequence for individual genes may be highly conserved (i.e., show limited sequence differences among different organisms) or be widely variable. As discussed in Chapter 8, these similarities and differences in gene content and sequences are the basis for the development of molecular methods used to detect, identify, and characterize clinically relevant microorganisms.

Chromosomes The genome is organized into discrete elements known as chromosomes. The set of genes within a given chromosome are arranged in a linear fashion, but the number of genes per chromosome is variable. Similarly, although the number of chromosomes per cell is consistent for a given species, this number varies considerably among species. For example, human cells contain 23 pairs (i.e., diploid) of chromosomes, whereas bacteria contain a single, unpaired (i.e., haploid) chromosome. Bacteria are classified as prokaryotes; therefore, the chromosome is not located in a membrane-bound organelle (i.e., nucleus). The bacterial chromosome contains the genes essential for viability and exists as a double-stranded, closed, circular macromolecule. The molecule is extensively folded and twisted (i.e., supercoiled) to fit within the confined space of the bacterial cell. The linearized, unsupercoiled chromosome of the bacterium Escherichia coli is about 130 mm long, but it fits within a cell 1 3 3 mm; this attests to the extreme compact structure of the supercoiled bacterial chromosome. For genes in the compacted chromosome to be expressed and replicated, unwinding or relaxation of the molecule is required. In contrast to the bacterial chromosome, the chromosomes of parasites and fungi number more than one per cell, are linear, and are housed within a membrane-bound organelle (the nucleus) of the cell. This difference is a major criterion for classifying bacteria as prokaryotes and fungi and parasites as eukaryotes. The genetic makeup of a virus may consist of DNA or RNA contained within a protein coat rather than a cell.

Nonchromosomal Elements Although the bacterial chromosome represents the majority of a cell's genome, not all genes are confined to the chromosome. Many genes may also be located on plasmids and transposable elements. Both of these extrachromosomal elements are able to replicate and encode information for the production of various cellular products. Many of these elements replicate by integration into the host chromosome, whereas others, referred to as episomes, are capable of

Nucleotide

3’ hydroxyl H O

5’ phosphate

Deoxyribose 3’ sugar

H

O

H 2C

O

H

O

1’

H

H

H

-O P= O

Phosphodiester bond

5’

3’

H

3’ O

H H

H

O

H

-O P= O

H

T

A

O

H

CH2

H

Base

O

H

O - P O - Base-pair

H

O O

C

O

O

H

H H

O

H

H

-O P= O

T

A G A

H2C

H

H

H

-O P= O

H

G

O

H2C

H2C

C

C T

H

O

T

O H

-O P= O

H

H

A

T

H

O

H H

H

O

H

G

-O P= O

H

A

O

O

H 2C

H

O O

G

O H

H

H H

-O P= O

H

O

H H

H

3’ O

H

-O P= O

H

C C

O

H2C

H2C

O O

O H

O

H

H

5’

5’ phosphate

B

3’ hydroxyl

A

3’

O

H

O- P O-

H

A

T

O

CH2

H2C

Helix

• Figure 2-2  A, Molecular structure of deoxyribonucleic acid (DNA) depicting nucleotide structure, phosphodiester bonds connecting nucleotides, and complementary base pairing (A, adenine; T, thymine; G, guanine; C, cytosine) between antiparallel nucleic acid strands. B, 59 and 39 antiparallel polarity and double-helix configuration of DNA.

NH2

O

N H

O

N H

O

N H

Cytosine C

Thymine T

Uracil U

DNA and RNA

DNA only

RNA only

• Figure 2-3  Molecular

N

N

N

N

NH2

O

H3C

O

N H

O N

N Adenine A

N

N

N H

N

NH2

Guanine G DNA and RNA

structure of nucleic acid bases. Pyrimidines: cytosine, thymine, and uracil. Purines: adenine and guanine.

8 PA RT I   Basic Medical Microbiology

replication independently of the host chromosome. Although considered part of the bacterial genome, they are not as stable as the chromosome and may be lost during cellular replication, often without any detrimental effects on the viability of the cell. Plasmids exist as double-stranded, closed, circular, autonomously replicating extrachromosomal genetic elements ranging in size from 1 to 2 kilobases up to 1 megabase or more. The number of plasmids per bacterial cell varies extensively, and each plasmid is composed of several genes. Some genes encode products that mediate plasmid replication and transfer between bacterial cells, whereas others encode products that provide a specialized function, such as a determinant of antimicrobial resistance or a unique metabolic process. Unlike most chromosomal genes, plasmid genes do not usually encode for products essential for viability. Plasmids, in whole or in part, may also become incorporated into the chromosome. Transposable elements are pieces of DNA that move from one genetic element to another, from plasmid to chromosome or vice versa. Unlike plasmids, many are unable to replicate independently and do not exist as separate entities in the bacterial cell. The two types of transposable elements are the simple transposon or insertion sequence (IS) and the composite transposon. Insertion sequences are limited to containing the genes that encode information required for

movement from one site in the genome to another. Composite transposons are cassettes (grouping of genes) flanked by insertion sequences. The internal gene embedded in the insertion sequence encodes for an accessory function, such as antimicrobial resistance. Plasmids and transposable elements coexist with chromosomes in the cells of many bacterial species. These extrachromosomal elements play a key role in the exchange of genetic material throughout the bacterial microbiosphere, including genetic exchange among clinically relevant bacteria.

Replication and Expression of Genetic Information Replication Bacteria multiply by binary fission (a form of cell division), resulting in the production of two daughter cells from one parent cell. As part of this process, the genome must be replicated so that each daughter cell receives an identical copy of functional DNA. Replication is a complex process mediated by various enzymes, such as DNA polymerase and cofactors; replication must occur quickly and accurately. For descriptive purposes, replication may be considered in four stages (Figure 2-4): 1. Unwinding or relaxation of the chromosome’s supercoiled DNA 5’

3’

Bidirectional replication

C A G G T C A

C G A G T G C C

G

G 5’ 3’

Daughter strand

T T A C A T G

5’ 3’

5’

G C G T A

3’ 5’

C

5’

3’ 5’ 3’ 5’ 5’ 3’

C G A

T

3’

T

C

Origin of replication

Replication

DNA polymerase

G C T A C G C G

Replication fork

Replication

A

5’

A A T T T A C

3’

Daughter strand

T A C G G C A T A T T A G C C G G C A T 3’ 5’ Parent strands

Terminus

• Figure 2-4  Bacterial DNA replication with bidirectional movement of two replication forks from the origin

of replication. Each parent strand serves as a template for production of a complementary daughter strand and, eventually, two identical chromosomes.

3’

CHAPTER 2  Bacterial Genetics, Metabolism, and Structure

2. Separation of the complementary strands of the parental DNA so that each may serve as a template (i.e., pattern) for synthesis of new DNA strands, referred to as semiconservative replication 3. Synthesis of the new (i.e., daughter) DNA strands 4. Termination of replication, releasing two identical chromosomes, one for each daughter cell Relaxation of supercoiled chromosomal DNA is required so that enzymes and cofactors involved in replication can access the DNA molecule at the site where the replication process will originate (i.e., origin of replication). The origin of replication (a specific sequence of approximately 300 base pairs) is recognized by several initiation proteins, followed by the separation of the complementary strands of parental DNA. Each parental strand serves as a template for the synthesis of a new complementary daughter strand. The site of active replication is referred to as the replication fork; two bidirectional forks are involved in the replication process. Each replication fork moves through the parent DNA molecule in opposite directions as a bidirectional process. Activity at each replication fork involves different cofactors and enzymes, with DNA polymerase playing a central role. Using each parental strand as a template, DNA polymerase adds nucleotide bases to each growing daughter strand in a sequence that is complementary to the base sequence of the template (parent) strand. The complementary bases of each strand are then held together by hydrogen bonding between nucleotides and the hydrophobic nature of the nitrogenous bases. The new nucleotides can be added only to the 39 hydroxyl end of the growing strand. The synthesis for each daughter strand occurs in the 59 to 39 direction. Termination of replication occurs when the replication forks meet. The result is two complete chromosomes, each containing two complementary strands, one of parental origin and one newly synthesized daughter strand. Although the time required for replication can vary among bacteria, the process generally takes approximately 20 to 40 minutes in rapidly growing bacteria such as E. coli. The replication time for a particular bacterial strain can vary depending on environmental conditions, such as the availability of nutrients or the presence of toxic substances (e.g., antimicrobial agents).

Expression of Genetic Information Gene expression is the processing of information encoded in genetic elements (i.e., chromosomes, plasmids, and transposons) that results in the production of biochemically functional molecules, including RNA and proteins. The overall process of gene expression is composed of two steps, transcription and translation. Gene expression requires various components, including a DNA template representing a single gene or cluster of genes, various enzymes and cofactors, and RNA molecules of specific structure and function. Transcription

Gene expression begins with transcription. During transcription the DNA base sequence of the gene (i.e., the

9

DNA coding strand 5’• • • C T T

T T T G T T A T T C A G C A T • • • 3’

3’ • • • G A A

A A A C A A T A A G T C G T A • • • 5’ RNA polymerase

Transcription

DNA template

5’ C U U U U U G U U A U U C A G C A U 3’ mRNA

Ribosomes, tRNA, amino acids, cofactors

Translation H2N

leu

phe

val

iso

glu

his

COOH

Polypeptide

• Figure 2-5  Overview of gene expression components: transcription

for production of mRNA and translation for production of a polypeptide (protein).

genetic code) is converted into an mRNA molecule that is complementary to the gene’s DNA sequence (Figure 2-5). Usually only one of the two DNA strands (sense strand) encodes for a functional gene product. This same strand is the template for mRNA synthesis. RNA polymerase is the enzyme central to the transcription process. The enzyme is composed of four protein subunits and a sigma (s) factor. Sigma factors are required for the RNA polymerase to identify the appropriate site on the DNA template where transcription of mRNA is initiated. This initiation site is also known as the promoter sequence. The remainder of the enzyme functions to unwind the dsDNA at the promoter sequence and use the DNA strand as a template to sequentially add ribonucleotides (ATP, GTP, UTP, and CTP) to form the growing mRNA strand. Transcription proceeds in a 59 to 39 direction. However, in mRNA, the TTP of DNA is replaced with UTP. TTP contains thymine, and UTP contains uracil. Both molecules contain a heterocyclic ring and are classified as pyrimidines. During synthesis and modification of these molecules, a portion of the molecules are dehydroxylated, forming a 29-deoxynucleotide monophosphate. The dehydroxylated uracil monophosphate (dUMP) is then methylated, forming dehydroxylated thymine monophosphate (dTMP). After phosphorylation, thymine is only found in the final state as deoxythymidine and therefore cannot be incorporated into an RNA molecule. Synthesis of the single-stranded mRNA product ends when specific nucleotide base sequences on the DNA template are encountered. Termination of transcription may be facilitated by a rho (a prokaryotic protein) cofactor or an intrinsic termination sequence. Both of these mechanisms disrupt the mRNA-RNA polymerase template DNA complex. In bacteria, the mRNA molecules that result from the transcription process are polycistronic; that is, they encode for several gene products. Polycistronic mRNA may encode

10 PA RT I   Basic Medical Microbiology

several genes whose products (proteins) are involved in a single or closely related cellular function. When a cluster of genes is under the control of a single promoter sequence, the gene group is referred to as an operon. The transcription process not only produces mRNA but also tRNA, rRNA, and regulatory ncRNA molecules. All types of RNA molecules have key roles in protein synthesis. To initiate transcription, accessory factors are needed to localize the RNA polymerase to the promoter upstream of the coding sequence. In bacteria, the s factor binds to the RNA polymerase and recognizes the gene-specific promotor. In some bacteria a small regulatory RNA, 6S RNA, binds the sigma factor to repress transcription in the late stationary phase of bacterial growth. The 6S RNA binds and forms a bulge or loop. The loop serves as an RNA-dependent site for RNA synthesis. The RNA synthesized from the loop is referred to as pRNA. When sufficient pRNA is produced, it causes the 6S RNA to detach from the promotor, permitting transcription to continue. tRNA binds to the A site in the ribosome and delivers the appropriate amino acid during elongation. However, tRNAs exist in many more diverse forms than once believed. In bacteria, the initiation codon codes for a N-formylmethionine. This modified amino acid is never placed inside the coding sequence of a bacterial protein. In other words, there are two forms of tRNA that are produced in bacteria that are cable of carrying methionine. One is the initiator tRNAMet and the other is the elongation tRNAMet. The elongation tRNAMet binds to the A site of the ribosome, whereas the initiation tRNAMet is only capable of binding to the P site within the ribosome. The binding of the elongation-specific tRNA is controlled by transcription elongation factor 1. rRNA, specifically the 16S rRNA, has historically been associated with classification of organisms based on evolutionary relatedness. The 16S rRNA is present in all organisms and is responsible for catalyzing the peptidyl transferase reaction during protein synthesis. A very small portion of the molecule is capable of undergoing genetic changes without deleterious effects to the transcription process, providing a means to monitor the evolutionary development of bacterial species. In addition to the differences in tRNA specificity, bacteria have developed a plethora of mechanisms to regulate gene transcription and respond to the environment, including transcriptional and posttranscriptional regulation. Many sensory and regulatory RNA molecules have now been identified that serve as RNA thermosensors and riboswitches. These molecules may undergo structural alterations during temperature changes or serve as antisense RNAs and small regulatory RNAs that bind to mRNA sequences to suppress and alter gene expression. This reversible regulation is clearly evident in the expression of virulence genes in many known pathogens including E. coli, Shigella spp., and Yersinia spp. The global changes of RNA expression within the transcriptome of a pathogenic bacteria allows the organism to rapidly adjust to changes in the environment associated

with temperature, ionic conditions, oxygen conditions, pH, calcium, and iron and other metals to maintain growth and survival. Translation

The next phase in gene expression, translation, involves protein synthesis. Through this process the genetic code in mRNA molecules is translated into specific amino acid sequences that are responsible for protein structure and function (see Figure 2-5). Before addressing the process of translation, a discussion of the genetic code that is originally transcribed from DNA to mRNA and then translated from mRNA to protein is warranted. The code consists of triplets of nucleotide bases, referred to as codons; each codon encodes for a specific amino acid. Because there are 64 different codons for 20 amino acids, an amino acid can be encoded by more than one codon (Table 2-1). Each codon is specific for a single amino acid. Therefore through translation, the codon sequences in mRNA direct which amino acids are added and in what order. Translation ensures that proteins with proper structure and function are produced. Errors in the process can result in aberrant proteins that are nonfunctional, underscoring the need for translation to be well controlled and accurate. To accomplish the task of translation, intricate interactions between mRNA, tRNA, and rRNA are required. Sixty different standard types of tRNA molecules are responsible for transferring different amino acids from intracellular reservoirs to the site of protein synthesis. These molecules, which have a structure that resembles an inverted t, contain one anticodon (sequence recognition site) for binding to specific codons (3-base sequences) on the mRNA molecule (Figure 2-6). A second site binds specific amino acids, the building blocks of proteins. Each amino acid is joined to a specific tRNA molecule through the enzymatic activity of aminoacyl-tRNA synthetases. Therefore tRNA molecules have the primary function of using the codons of the mRNA molecule as the template for precisely delivering a specific amino acid for polymerization. Ribosomes, which are compact nucleoproteins, are composed of rRNA and proteins. They are central to translation, assisting with the coupling of all required components and controlling the translational process. Translation, diagrammatically shown in Figure 2-6, involves three steps: initiation, elongation, and termination. After termination, bacterial proteins often undergo posttranslational modifications as a final step in protein synthesis. Initiation begins with the association of ribosomal subunits, mRNA, formylmethionine (f-met) tRNA (carrying the initial amino acid of the protein to be synthesized), and various initiation factors (Figure 2-6, A). Assembly of the complex begins at a specific 3- to 9-base (ShineDalgarno sequence) on the mRNA about 10 bp upstream of the AUG start codon. After the initial complex has been formed, addition of individual amino acids begins.

CHAPTER 2  Bacterial Genetics, Metabolism, and Structure

11

TABLE The Genetic Code as Expressed by Triplet-Base Sequences of mRNA* 2-1

Codon

Amino acid

Codon

Amino acid

Codon

Amino acid

Codon

Amino acid

UUU

Phenylalanine

CUU

Leucine

GUU

Valine

AUU

Isoleucine

UUC

Phenylalanine

CUC

Leucine

GUC

Valine

AUC

Isoleucine

UUG

Leucine

CUG

Leucine

GUG

Valine

AUG (start)†

Methionine

UUA

Leucine

CUA

Leucine

GUA

Valine

AUA

Isoleucine

UCU

Serine

CCU

Proline

GCU

Alanine

ACU

Threonine

UCC

Serine

CCC

Proline

GCC

Alanine

ACC

Threonine

UCG

Serine

CCG

Proline

GCG

Alanine

ACG

Threonine

UCA

Serine

CCA

Proline

GCA

Alanine

ACA

Threonine

UGU

Cysteine

CGU

Arginine

GGU

Glycine

AGU

Serine

UGC

Cysteine

CGC

Arginine

GGC

Glycine

AGC

Serine

UGG

Tryptophan

CGG

Arginine

GGG

Glycine

AGG

Arginine

UGA

None (stop signal)

CGA

Arginine

GGA

Glycine

AGA

Arginine

UAU

Tyrosine

CAU

Histidine

GAU

Aspartic

AAU

Asparagine

UAC

Tyrosine

CAC

Histidine

GAC

Aspartic

AAC

Asparagine

UAG

None (stop signal)

CAG

Glutamine

GAG

Glutamic

AAG

Lysine

UAA

None (stop signal)

CAA

Glutamine

GAA

Glutamic

AAA

Lysine

*The codons in deoxyribonucleic acid (DNA) are complementary to those given here. Thus U is complementary to the A in DNA, C is complementary to G, G to C, and A to T. The nucleotide on the left is at the 59-end of the triplet. † AUG codes for N-formylmethionine at the beginning of messenger ribonucleic acid (mRNA) in bacteria. Modified from Brock TD, Madigan M, Martinko J, et al, editors: Biology of microorganisms, Upper Saddle River, NJ, 2009, Prentice Hall.

Elongation involves tRNAs and a host of elongation factors that mediate the sequential addition of amino acids in a specific sequence dictated by the codon on the mRNA molecule (Figure 2-6, B and C, and Table 2-1). As the mRNA molecule threads through the ribosome in a 59 to 39 direction, peptide bonds are formed between adjacent amino acids, still bound by their respective tRNA molecules in the peptide (P) and acceptor (A) sites of the ribosome. During the process, the forming peptide is moved to the P site, and the most 59 tRNA is released from the exit (E) site. This movement vacates the A site, which contains the codon specific for the next amino acid, so that the incoming tRNA2amino acid can join the complex (Figure 2-6, C ). Because multiple proteins encoded on an mRNA strand can be translated at the same time, multiple ribosomes may be simultaneously associated with one mRNA molecule. Such an arrangement is referred to as a polysome; its appearance resembles a string of pearls. Termination, the final step in translation, occurs when the ribosomal A site encounters a stop or nonsense codon that does not specify an amino acid (i.e., a “stop signal”; Table 2-1). At this point, the protein synthesis complex disassociates and the ribosomes are available for another round of translation. After termination, most proteins

must undergo modification, such as folding or enzymatic trimming, so that protein function, transportation, or incorporation into various cellular structures can be accomplished. This process is referred to as posttranslational modification.

Regulation and Control of Gene Expression The vital role that gene expression and protein synthesis play in the survival of cells dictates that bacteria judiciously control these processes. The cell must regulate gene expression and control the activities of gene products so that a physiologic balance is maintained. Regulation and control are also key factors. These are highly complex mechanisms by which single-cell organisms are able to respond and adapt to environmental challenges, regardless of whether the challenges occur naturally or result from medical intervention (e.g., antibiotics). Regulation occurs at one of three levels of information transfer from the gene expression and protein synthesis pathway: transcriptional, translational, or posttranslational. The most common is transcriptional regulation. Because direct interactions with genes and their ability to be transcribed to mRNA are involved, transcriptional regulation is also referred to as genetic control. Genes that encode

12 PA RT I   Basic Medical Microbiology

E site Ribosome

Amino acid

arg

A site

P site

tRNA

f-met

tRNA

Initiation

U C U

A

U

A

C

A

U

G

A

A

G

A

C

C

G

C

Messenger RNA codons

G

Start codon

Peptide bond A site P site

E site

f-met

thr

arg

U U

A

C

U

C

U

A

U

G

A G

A

A

C

C

G

G G

C

G

Elongation A

G

G

G

A

U

B

thr

arg

f-met

A site

P site

ala

asp

arg

E site

U

5’

A

U

G

U

Release of discharged tRNA

U

G

G

C

A G

A

A

C

C G G C

C

U

C

C

G

A

G

G

G

A

U

A

A

3’

C • Figure 2-6  Overview of translation in which mRNA serves as the template for the assembly of amino

acids into polypeptides. The three steps include initiation (A), elongation (B and C), and termination (not shown).

enzymes involved in anabolic processes (biosynthesis) and genes that encode enzymes for catabolic processes (biodegradation) are examples of genetic control. In general, genes that encode anabolic enzymes for the synthesis of particular products are repressed (i.e., are not transcribed and therefore are not expressed) in the

presence of the gene end product. This strategy prevents waste and overproduction of products that are already present in sufficient supply. In this system, the product acts as a corepressor that forms a complex with a repressor molecule. In the absence of corepressor product (i.e., gene product), transcription occurs (Figure 2-7, A). When present in

CHAPTER 2  Bacterial Genetics, Metabolism, and Structure

sufficient quantity, the product forms a complex with the repressor. The complex then binds to a specific base region of the gene sequence known as the operator region (Figure 2-7, B). This binding blocks RNA polymerase progression from the promoter sequence and inhibits transcription. As the supply of product (corepressor) dwindles, an insufficient amount remains to form a complex with the repressor. The operator region is no longer bound to the repressor molecule. Transcription of the genes for the anabolic enzymes commences and continues until a sufficient supply of end product is again available. In contrast to repression, genes that encode catabolic enzymes are usually induced; that is, transcription occurs only when the substrate to be degraded by enzymatic action is present. Production of degradative enzymes in the absence of substrates would be a waste of cellular energy and Repression Promotor

Operator

RNA polymerase

Gene 1

Gene 2

Gene 3

Transcription occurs Absence of corepressor (gene product)

Repressor

A Promotor

Operator

RNA Repressor polymerase

Gene 1

Gene 2

Gene 3

Transcription blocked Corepressor (gene product)

B

Operator

RNA Repressor polymerase

C

Gene 1

Gene 2

Gene 3

Transcription blocked by complex

Absence of substrate (inducer)

Promotor

Operator

RNA polymerase

Gene 1

Gene 2

Gene 3

Transcription occurs

Inducer Repressor

D

resources. When the substrate is absent in an inducible system, a repressor binds to the operator sequence of the DNA and blocks transcription of the gene for the degradative enzyme (Figure 2-7, C ). In the presence of an inducer, which often is the target substrate for degradation, a complex is formed between the inducer and the repressor that results in the release of the repressor from the operator site, allowing transcription of the genes encoding the specific catabolic enzyme (Figure 2-7, D). Certain genes are not regulated; that is, they are not under the control of inducers or repressors. These genes are referred to as constitutive. Because they usually encode for products that are essential for viability under almost all growth and environmental conditions, these genes are continuously expressed. Also, not all regulation occurs at the genetic level (i.e., transcriptional regulation). For example, the production of some enzymes may be controlled at the protein synthesis (i.e., translational) level. The activities of other enzymes that have already been synthesized may be regulated at a posttranslational level; that is, certain catabolic or anabolic metabolites may directly interact with enzymes either to increase or to decrease their enzymatic activity. Among different bacteria and even among different genes in the same bacterium, the mechanisms by which inducers and corepressors are involved in gene regulation vary widely. Furthermore, bacterial cells have mechanisms to detect environmental changes. These changes can generate signals that interact with the gene expression mechanism, ensuring that appropriate products are made in response to the environmental change. In addition, several complex interactions between different regulatory systems are found within a single cell. Such diversity and interdependence are necessary components of metabolism that allow an organism to respond to environmental changes in a rapid, wellcoordinated, and appropriate way.

Genetic Exchange and Diversity

Induction Promotor

13

Substrate (inducer) present

• Figure 2-7  Transcriptional

control of gene expression. A and B, Gene repression. C and D, Induction.

In eukaryotic organisms, genetic diversity is achieved by sexual reproduction, which allows for the mixing of genomes through genetic exchange. Bacteria multiply by simple binary cell division in which two identical daughter cells result by division of one parent cell. Each daughter cell receives the full genetic complement contained in the original parent cell. This process does not allow for the mixing of genes from other cells and leaves no means of achieving genetic diversity among bacterial progeny. Without genetic diversity and change, the essential ingredients for evolution are lost. However, microorganisms have been on earth for billions of years, and microbiologists have witnessed their ability to change as a result of exposure to chemicals (i.e., antibiotics) and environmental conditions (i.e., temperature or oxygenation). It is evident that these organisms are fully capable of evolving and altering their genetic composition. Genetic alterations and diversity in bacteria are accomplished by three basic mechanisms: mutation, genetic recombination, and genetic exchange between bacteria, with

14 PA RT I   Basic Medical Microbiology

or without recombination. Throughout diagnostic microbiology and infectious diseases, there are numerous examples of the effect these genetic alteration and exchange mechanisms have on clinically relevant bacteria and the management of the infections they cause.

Mutation Mutation is defined as an alteration in the original nucleotide sequence of a gene or genes within an organism’s genome; that is, a change in the organism’s genotype. This alteration may involve a single DNA base in a gene, an entire gene, or several genes. Mutational changes in the sequence may arise spontaneously, perhaps by an error made during DNA replication. Alternatively, mutations may be induced by mutagens (i.e., chemical or physical factors) in the environment or by biologic factors, such as the introduction of foreign DNA into the cell. Alterations in the DNA base sequence can result in changes in the base sequence of mRNA during transcription. This, in turn, can affect the types and sequences of amino acids that will be incorporated into the protein during translation. Depending on the site and extent of the mutation, various outcomes may affect the physiologic functions of the organism. For example, a mutation may be so devastating that it is lethal to the organism; the mutation, therefore, “dies” along with the organism. In other instances the mutation may be silent so that no changes are detected in the organism’s phenotype (i.e., observable properties). Alternatively, the mutation may result in a noticeable alteration in the organism’s phenotype, and the change may provide the organism with a survival advantage. This outcome, in Darwinian terms, is the basis for prolonged survival and evolution. Nonlethal mutations are considered stable if they are passed on from one generation to another as an integral part of the cell’s genotype (i.e., genetic composition). In addition, genes that have undergone stable mutations may also be transferred to other bacteria by one of the mechanisms of genetic exchange. In other instances, the mutation may be lost as a result of cellular repair mechanisms capable of restoring the original genotype and phenotype, or it may be lost spontaneously during subsequent cycles of DNA replication.

Genetic Recombination Besides mutations, bacterial genotypes can be altered through recombination. In this process, some segment of DNA originating from one bacterial cell (i.e., the donor) enters a second bacterial cell (i.e., the recipient) and is exchanged with a DNA segment of the recipient’s genome. This is also referred to as homologous recombination, because the pieces of DNA that are exchanged usually have extensive homology or similarities in their nucleotide sequences. Recombination involves a number of binding proteins, with the bacterial recombinase protein (RecA) playing a central role (Figure 2-8, A). RecA is capable of binding single-stranded DNA (ssDNA) to the complementary dsDNA, providing a mechanism for DNA repair and

recombination to occur. After recombination, the recipient DNA consists of one original, unchanged strand and a second strand from the donor DNA fragment that has been recombined. Recombination is a molecular event that occurs frequently in many varieties of bacteria, including most of the clinically relevant species, and it may involve any portion of the organism’s genome. However, the recombination event may go unnoticed unless the exchange of DNA results in a distinct alteration in the phenotype. Nonetheless, recombination is a major means by which bacteria may achieve genetic diversity and continue to evolve.

Genetic Exchange An organism’s ability to undergo recombination depends on the acquisition of “foreign” DNA from a donor cell. The three mechanisms by which bacteria physically exchange DNA are transformation, transduction, and conjugation. Transformation.

Transformation involves recipient cell uptake of naked (free) DNA released into the environment when another bacterial cell (i.e., the donor) dies and undergoes lysis (Figure 2-8, B). This genomic DNA exists as fragments in the environment. Certain bacteria are able to take up naked DNA from their surroundings; that is, they are able to undergo transformation. Such bacteria are said to be competent. Among the bacteria that cause human infections, competence is a characteristic commonly associated with members of the genera Haemophilus, Streptococcus, and Neisseria. Once the donor DNA, usually as a singular strand, gains access to the interior of the recipient cell, recombination with the recipient’s homologous DNA can occur. The mixing of DNA between bacteria via transformation and recombination plays a major role in the development of antibiotic resistance and in the dissemination of genes that encode factors essential to an organism’s ability to cause disease. In addition, gene exchange by transformation is not limited to organisms of the same species, thus allowing important characteristics to be disseminated to a greater variety of medically important bacteria. Transduction

Transduction is a second mechanism by which DNA from two bacteria may come together in one cell, thus allowing for recombination (Figure 2-8, C ). This process is mediated through viruses capable of infecting bacteria (i.e., bacteriophages). In their “life cycle,” these viruses integrate their DNA into the bacterial cell’s chromosome, where viral DNA replication and expression occur. When the production of viral products is complete, viral DNA is excised (cut) from the bacterial chromosome and packaged within a protein coat. The excision process is not always accurate, resulting in the removal of genetic material that contains both the bacterial and viral DNA. The newly formed recombinant virion, along with the additional multiple virions (virus particles), is released when the infected bacterial cell lyses.

CHAPTER 2  Bacterial Genetics, Metabolism, and Structure

15

A Recombination Rec A protein

Recipient DNA

Uptake of donor ("foreign") DNA

Alignment of donor DNA with homologous recipient DNA

Recombined DNA fragment (blue)

B Transformation Recipient

Donor Free DNA

Cell lysis and release of free DNA

Uptake and recombination

C Transduction

Donor cell DNA packaged in bacteriophage

Release of bacteriophage from donor cell

Bacteriophage infects and releases donor DNA

D Conjugation: Chromosome transfer Recipient (Final)

Recipient

Donor

Transfer of newly synthesized chromosomal DNA mobilized through intercellular bridge

E Conjugation: Plasmid transfer Recipient

Donor

Chromosome

Recipient (Final)

Plasmid

Transfer of newly synthesized plasmid DNA through intercellular bridge

• Figure 2-8  A,

Genetic recombination. The mechanisms of genetic exchange between bacteria are transformation (B), transduction (C), and conjugational transfer of chromosomal (D) and plasmid (E) DNA.

The bacterial DNA may be randomly incorporated with viral DNA (generalized transduction), or it may be incorporated along with adjacent viral DNA (specialized transduction). In generalized transduction, the viral DNA is inserted randomly into any area of the bacterial genome. However in specialized transduction, the virus inserts into particular genes in an organism based on sequence specificity and resulting in a higher frequency of genetic material in those regions to be transferred through recombination. In either case, when the viruses infect another bacterial cell, they release their DNA, which includes the previously incorporated bacterial donor DNA. Therefore the newly infected cell is the recipient of donor DNA introduced by

the bacteriophage, and recombination between DNA from two different cells occurs. Conjugation

The third mechanism of DNA exchange between bacteria is conjugation. This process occurs between two living cells, involves cell-to-cell contact, and requires mobilization of the donor bacterium’s chromosome. The nature of intercellular contact is not well characterized in all bacterial species capable of conjugation. However, in E. coli, contact is mediated by a sex pilus (Figure 2-9). The sex pilus originates from the donor and establishes a conjugative bridge that serves as the conduit for DNA transfer from donor to recipient

16 PA RT I   Basic Medical Microbiology

• Figure 2-9  Photomicrograph

of an Escherichia coli sex pilus between a donor and a recipient cell. (From Brock TD, Madigan M, Martinko J, et al, editors: Biology of microorganisms, Upper Saddle River, NJ, 2009, Prentice Hall.)

cell. With intercellular contact established, chromosomal mobilization is undertaken and involves DNA synthesis. One new DNA strand is produced by the donor and is passed to the recipient (Figure 2-8, D). The amount of DNA transferred depends on how long the cells are able to maintain contact, but usually only portions of the donor molecule are transferred. In any case, the newly introduced DNA is then available to recombine with the recipient’s genome. In addition to chromosomal DNA, genes encoded in extrachromosomal genetic elements, such as plasmids and transposons, may be transferred by conjugation (Figure 2-8, E ). Not all plasmids are capable of conjugative transfer, but for those that are, the donor plasmid usually is replicated so that the donor retains a copy of the plasmid transferred

to the recipient. (See the discussion of the F plasmid in the section Cellular Appendages, later in the chapter.) Plasmid DNA may also become incorporated into the host cell’s chromosome. In contrast to plasmids, most transposons do not exist independently in the cell. Except when they are moving from one location to another, many transposons must be incorporated into the chromosome, plasmids, or both. These elements are often referred to as “jumping genes” because of their ability to change location within and even between the genomes of bacterial cells. Transposition is the process by which these genetic elements excise from one genomic location and insert into another. Transposons carry genes that have products that help mediate the transposition process, in addition to genes that encode for other accessory characteristics, such as antimicrobial resistance. Homologous recombination between the genes of plasmids or transposons and the host bacterium’s chromosomal DNA may occur. Plasmids and transposons play a key role in genetic diversity and the dissemination of genetic information among bacteria. Many characteristics that significantly alter the activities of clinically relevant bacteria are encoded and disseminated on these elements. Furthermore, as shown in Figure 2-10, the variety of strategies that bacteria can use to mix and match genetic elements provides them with a tremendous capacity to genetically adapt to environmental changes, including those imposed by human medical practices. A good example of this is the emergence and widespread dissemination of resistance to antimicrobial agents among clinically important bacteria. Bacteria have used their capacity for disseminating genetic information to establish

Donor organism Chromosome Plasmids Transposon

Donor

Recipient

• Figure 2-10  Pathways

independently.

Potential for subsequent dissemination of plasmids and transposons to a variety of other recipients

for bacterial dissemination of plasmids and transposons, together and

CHAPTER 2  Bacterial Genetics, Metabolism, and Structure

resistance to many of the commonly prescribed antibiotics. (See Chapter 10 for more information about antimicrobial resistance mechanisms.)

Bacterial Metabolism Fundamentally, bacterial metabolism involves all the cellular processes required for the organism’s survival and replication. Familiarity with bacterial metabolism is essential to understand bacterial interactions with human host cells, the mechanisms bacteria use to cause disease, and the basis of diagnostic microbiology; that is, the tests and strategies used for laboratory identification of infectious organisms. Because metabolism is an extensive and complicated topic, this section focuses on processes typical of medically relevant bacteria. For the sake of clarity, metabolism is discussed in terms of four primary, but interdependent, processes: fueling, biosynthesis, polymerization, and assembly (Figure 2-11).

Fueling Fueling is considered the utilization of metabolic pathways involved in the acquisition of nutrients from the environment, production of precursor metabolites, and energy production.

Acquisition of Nutrients Bacteria use various strategies for obtaining essential nutrients from the external environment and transporting these substances into the cell’s interior. For nutrients to be internalized, they must cross the bacterial cell wall and membrane. These complex structures help protect the cell from environmental insults, maintain intracellular equilibrium, and transport substances into and out of the cell. Although some key nutrients (e.g., water, oxygen, and carbon dioxide) enter the cell by simple diffusion across the cell membrane, the uptake of other substances is controlled by membraneselective permeability; still other substances use specific transport mechanisms. Active transport is among the most common methods used for the uptake of nutrients such as certain sugars, most amino acids, organic acids, and many inorganic ions. The mechanism, driven by an energy-dependent pump, involves carrier molecules embedded in the membrane portion of the cell structure. These carriers combine with the nutrients, transport them across the membrane, and release them inside the cell. Group translocation is another transport mechanism that requires energy but differs from active transport in that the nutrients being transported undergoes chemical modification. Many sugars, purines, pyrimidines, and fatty acids are transported by this mechanism.

Production of Precursor Metabolites Once inside the cell, many nutrients serve as the raw materials from which precursor metabolites for subsequent biosynthetic processes are produced. These metabolites, listed in Figure 2-11, are produced through two central

17

pathways: the Embden-Meyerhof-Parnas (EMP) pathway (glycolysis) and the tricarboxylic acid (TCA) cycle. The two major pathways and their relationship to one another are shown in Figure 2-12; not shown are the alternative pathways (e.g., the Entner-Doudoroff and the pentose phosphate pathway) that play key roles in redirecting and replenishing the precursors as they are used in subsequent processes. The Entner-Doudoroff pathway catalyzes the degradation of gluconate and glucose. The gluconate is phosphorylated, dehydrated, and converted into pyruvate and glyceraldehyde, leading to ethanol production. Alternatively, the pentose phosphate pathway uses glucose to produce reduced nicotinamide adenine dinucleotide phosphate (NADPH), pentoses, and tetroses for biosynthetic reactions such as nucleoside and amino acid synthesis. The production efficiency of a bacterial cell resulting from these precursor-producing pathways can vary substantially, depending on the growth conditions and availability of nutrients. This is an important consideration, because the accurate identification of medically important bacteria often depends heavily on methods that measure the presence of products and byproducts of these metabolic pathways.

Energy Production The third type of fueling pathway is one that produces the energy required for nearly all cellular processes, including nutrient uptake and precursor production. Energy production is accomplished by the breakdown of chemical substrates (i.e., chemical energy) through the degradative process of catabolism coupled with oxidation-reduction reactions. In this process, the energy source molecule (i.e., substrate) is oxidized as it donates electrons to an electronacceptor molecule, which is then reduced. The transfer of electrons is mediated through carrier molecules, such as nicotinamide-adenine-dinucleotide (NAD1) and nicotinamide-adenine-dinucleotide-phosphate (NADP1). The energy released by the oxidation-reduction reaction is transferred to phosphate-containing compounds, where highenergy phosphate bonds are formed. ATP is the most common of such molecules. The energy contained in this compound is eventually released by the hydrolysis of ATP under controlled conditions. The release of this chemical energy, coupled with enzymatic activities, specifically catalyzes each biochemical reaction in the cell and drives cellular reactions. The two general mechanisms for ATP production in bacterial cells are substrate-level phosphorylation and electron transport, also referred to as oxidative phosphorylation. In substrate-level phosphorylation, high-energy phosphate bonds produced by the central pathways are donated to adenosine diphosphate (ADP) to form ATP directly from the substrate as opposed to generation via the electron transport chain (Figure 2-12). In addition, pyruvate, a primary intermediate in the central pathways, serves as the initial substrate for several other pathways to generate ATP by substrate-level phosphorylation. These other pathways constitute fermentative metabolism, which does not require oxygen and produces various end products, including alcohols, acids, carbon dioxide,

18 PA RT I   Basic Medical Microbiology

Precursor metabolites • Glucose 6-phosphate • Fructose 6-phosphate • Pentose 5-phosphate • Erythrose 4-phosphate • 3-Phosphoglycerate • Phosphoenolpyruvate • Pyruvate • Acetyl CoA • F-Ketoglutarate • Succinyl CoA • Oxaloacetate Biosynthetic reactions

Metabolic reactions Precursor metabolites

Assembly reactions

Polymerizations Lipid

Inclusions

Fatty acids Lipopolysaccharide

Metabolic energy

Glucose

Sugars

Glycogen

Envelope Flagella

Murein Pili

Amino acids

Nutrients

Protein Cytosol RNA Polyribosomes

Nucleotides DNA Metabolic products

Building blocks

Macromolecules

Nucleoid Structures

Nutrients • Gases Carbon dioxide (CO2) Oxygen (O2) Ammonia (NH3) • Organic compounds, including amino acids • Water (H2O) • Nitrate (NO3-) • Phosphate (PO43-) • Hydrogen sulfide (H2S) • Sulfate (SO42-) • Potassium (K+) • Magnesium (Mg2+) • Calcium (Ca2+) • Sodium (Na+) • Iron (Fe3+) Organic iron complexes

• Figure 2-11  Overview of bacterial metabolism, which includes the processes of fueling, biosynthesis, polymerization, and assembly. (Modified from Niedhardt FC, Ingraham JL, Schaechter M, editors: Physiology of the bacterial cell: a molecular approach, Sunderland, MA, 1990, Sinauer Associates.)

CHAPTER 2  Bacterial Genetics, Metabolism, and Structure

and hydrogen. The specific fermentative pathways and the end products produced vary with different bacterial species. Detection of these products is an important basis for laboratory identification of bacteria. (See Chapter 7 for more information on the biochemical basis for bacterial identification.)

respiration refers to processes that use final electron acceptors other than oxygen. A knowledge of which mechanisms bacteria use to generate ATP is important for designing laboratory protocols for cultivating and identifying these organisms. For example, some bacteria depend solely on aerobic respiration and are unable to grow in the absence of oxygen (strictly aerobic bacteria). Others can use either aerobic respiration or fermentation, depending on the availability of oxygen (facultative anaerobic bacteria). For still others, oxygen is absolutely toxic (strictly anaerobic bacteria).

Oxidative Phosphorylation

Oxidative phosphorylation involves an electron transport system that conducts a series of electron transfers from reduced carrier molecules such as NADH2, NADPH2 and FADH2 (flavin adenine dinucleotide), produced in the central pathways (Figure 2-12), to a terminal electron acceptor. The energy produced by the series of oxidation-reduction reactions is used to generate ATP from ADP. When oxidative phosphorylation uses oxygen as the terminal electron acceptor, the process is known as aerobic respiration. Anaerobic

Biosynthesis The fueling reactions essentially bring together all the raw materials needed to initiate and maintain all other

Glucose

NADPH2

P Glucose 6-phosphate

6-Phosphogluconolactone

6-Phosphogluconate NADPH2 Pentose 5-phosphate*

Fructose 6-phosphate P

Erythrose 4-phosphate

Fructose 1,6-diphosphate Pentose phosphate cycle Triose 3-phosphate FADH2 NADH2 1,3-Diphosphoglycerate

Succinate

Fumarate

P

P

3-Phosphoglycerate P Malate

2-Phosphoglycerate

NADH2 Phosphoenolpyruvate P

TCA cycle

Succinyl CoA NADH2

P

Oxaloacetate

α-Ketoglutarate

NADH2

PYRUVATE

NADPH2 Acetyl CoA

19

Citrate

Isocitrate

EMP Pathway

• Figure 2-12  Overview of the central metabolic pathways (Embden-Meyerhof-Parnas [EMP], the tricarbox-

ylic acid [TCA] cycle, and the pentose phosphate shunt). Precursor metabolites (see also Figure 2-11) that are produced are highlighted in red; production of energy in the form of ATP (,P) by substrate-level phosphorylation is highlighted in yellow; and reduced carrier molecules for transport of electrons used in oxidative phosphorylation are highlighted in green. (Modified from Niedhardt FC, Ingraham JL, Schaechter M, editors: Physiology of the bacterial cell: a molecular approach, Sunderland, MA, 1990, Sinauer Associates.)

20 PA RT I   Basic Medical Microbiology

cellular processes. The production of precursors and energy is accomplished through catabolic processes and the degradation of substrate molecules. The three remaining pathways for biosynthesis, polymerization, and assembly depend on anabolic metabolism. In anabolic metabolism, precursor compounds are joined for the creation of larger molecules (polymers) required for assembly of cellular structures (Figure 2-11). Biosynthetic processes use the precursor products in dozens of pathways to produce a variety of building blocks, such as amino acids, fatty acids, sugars, and nucleotides (Figure 2-11). Many of these pathways are highly complex and interdependent, whereas other pathways are completely independent. In many cases, the enzymes that drive the individual pathways are encoded on a single mRNA molecule that has been transcribed from contiguous genes in the bacterial chromosome (i.e., an operon). As previously mentioned, bacterial genera and species vary extensively in their biosynthetic capabilities. Knowledge of these variations is necessary to use optimal conditions for growing organisms under laboratory conditions. For example, some organisms may not be capable of synthesizing an essential amino acid necessary as a building block for proteins. Without the ability to synthesize the amino acid, the bacterium must obtain the building block from the environment. Thus if the organism is cultivated in the microbiology laboratory, the amino acid must be provided in the culture medium.

A notable characteristic of eukaryotic cells, such as parasites and fungi, is the presence of membrane-enclosed organelles that have specific cellular functions. Examples of these organelles and their respective functions include: • Endoplasmic reticulum—process and transport proteins • Golgi body—modification of substances and transport throughout the cell, including internal delivery of molecules, and exocytosis or secretion of other molecules • Mitochondria—generate energy (ATP) • Lysosomes—provide an environment for controlled enzymatic degradation of intracellular substances • Nucleus—provide a membrane enclosure for chromosomes In addition, eukaryotic cells have an infrastructure, or cytoskeleton, that provides support for cellular structure, organization, and movement. The cytoskeleton in eukaryotic cells also plays an essential role in immunology by mediating phagocytosis for the removal of foreign materials from the host, including bacteria, fungi, and viral agents. Prokaryotic cells, such as bacteria, do not contain organelles. All functions take place in the cytoplasm or cytoplasmic membrane of the cell. Prokaryotic and eukaryotic cell types differ considerably at the macromolecular level, including protein synthesis machinery, chromosomal organization, and gene expression. One notable structure present only in prokaryotic bacterial cells is a cell wall composed of peptidoglycan. This structure has an immeasurable effect on the practice of diagnostic bacteriology and the management of bacterial diseases.

Polymerization and Assembly

Bacterial Morphology

Various anabolic reactions assemble (polymerize) the building blocks into macromolecules, including lipids, lipopolysaccharides, polysaccharides, proteins, and nucleic acids. This synthesis of macromolecules is driven by energy and enzymatic activity in the cell. Similarly, energy and enzymatic activities also drive the assembly of various macromolecules into the component structures of the bacterial cell. Cellular structures are the product of all the genetic and metabolic processes discussed.

Most clinically relevant bacterial species range in size from 0.25 to 1 mm in width and 1 to 3 mm in length, thus requiring microscopy for visualization (see Chapter 6 for more information on microscopy). Just as bacterial species and genera vary in their metabolic processes, their cells also vary in size, morphology, and cell-to-cell arrangements and in the chemical composition and structure of the cell wall. The bacterial cell wall differences provide the basis for the Gram stain, a fundamental staining technique used in bacterial identification schemes. This staining procedure separates almost all medically relevant bacteria into two general types: gram-positive bacteria, which stain a deep blue or purple, and gram-negative bacteria, which stain a pink to red (Figure 6-3). This simple but important color distinction is the result of differences in the constituents of bacterial cell walls that influence the cell’s ability to retain differential dyes after treatment with a decolorizing agent. Common bacterial cellular morphologies include cocci (circular), coccobacilli (ovoid), and bacilli (rod shaped), as well as fusiform (pointed end), curved, or spiral shapes. Cellular arrangements are also noteworthy. Cells may characteristically occur singly, in pairs, or grouped as tetrads, clusters, or in chains (see Figure 6-4 for examples of bacterial staining and morphologies). The determination of the Gram stain reaction and the cell size, morphology, and arrangement are essential aspects of bacterial identification.

Structure and Function of the Bacterial Cell Based on key characteristics, all cells are classified into two basic types: prokaryotic and eukaryotic. Although these two cell types share many common features, they have important differences in terms of structure, metabolism, and genetics.

Eukaryotic and Prokaryotic Cells Among clinically relevant organisms, bacteria are single-cell prokaryotic microorganisms. Fungi and parasites are single-cell or multicellular eukaryotic organisms, as are plants and all higher animals. Viruses are dependent on host cells for survival and therefore are not considered cellular organisms but rather infectious agents. Prions, which are abnormal infectious proteins, are also not considered living cells.

CHAPTER 2  Bacterial Genetics, Metabolism, and Structure

Bacterial Cell Components Bacterial cell components can be divided into those that make up the outer cell structure and its appendages (cell envelope) and those associated with the cell’s interior. It is important to note that the cellular structures work together to function as a complex and integrated unit.

Cell Envelope As shown in Figure 2-13, the outermost structure, the cell envelope, comprises: • An outer membrane (in gram-negative bacteria only) • A cell wall composed of the peptidoglycan macromolecule (also known as the murein layer) • Periplasm (in gram-negative bacteria only) • The cytoplasmic or cell membrane, which encloses the cytoplasm Outer Membrane

Outer membranes, which are found only in gram-negative bacteria, function as the cell’s initial barrier to the environment. These membranes serve as primary permeability barriers to hydrophilic and hydrophobic compounds and contain essential enzymes and other proteins located in the periplasmic space. The membrane is a bilayered structure composed of lipopolysaccharide, which gives the surface of gram-negative bacteria a net negative charge. The outer membrane also plays a significant role in the ability of certain bacteria to cause disease.

Scattered throughout the lipopolysaccharide macromolecules are protein structures called porins. These waterfilled structures control the passage of nutrients and other solutes, including antibiotics, through the outer membrane. The number and types of porins vary with bacterial species. These differences can substantially influence the extent to which various substances pass through the outer membranes of different bacteria. In addition to porins, other proteins (murein lipoproteins) facilitate the attachment of the outer membrane to the next internal layer in the cell envelope, the cell wall, and may serve as adhesions for attachment to a host cell or as transporters. Cell Wall (Murein Layer)

The cell wall, also referred to as the peptidoglycan, or murein layer, is an essential structure found in nearly all clinically relevant bacteria. This structure gives the bacterial cell shape and strength to withstand changes in environmental osmotic pressures that would otherwise result in cell lysis. The murein layer protects against mechanical disruption of the cell and offers some barrier to the passage of larger substances. Because this structure is essential for the survival of bacteria, its synthesis and structure are often the primary targets for the development and design of several antimicrobial agents. The structure of the cell wall is unique and is composed of disaccharide-pentapeptide subunits. The disaccharides N-acetylglucosamine and N-acetylmuramic acid are the alternating sugar components (moieties) with the

Flagellum

Pilus

Lipopolysaccharide Porin

Capsule (variable) Outer membrane

L-ring

Murein Periplasmic space

Basal body rings

P-ring S-ring M-ring C-ring

Cytoplasmic membrane

Gram-positive

21

Gram-negative

• Figure 2-13  General structures of the gram-positive and gram-negative bacterial cell envelopes. The outer membrane and periplasmic space are present only in the envelope of gram-negative bacteria. In addition to porins, bacterial membranes contain additional proteins involved in stabilizing the layers of the cellular structure, adherence, or sorting and reacting to chemical signals. The murein layer is substantially more prominent in gram-positive envelopes. (Modified from Niedhardt FC, Ingraham JL, Schaechter M, editors: Physiology of the bacterial cell: a molecular approach, Sunderland, MA, 1990, Sinauer Associates.)

22 PA RT I   Basic Medical Microbiology

NAM NAM NAM NAM NAG NAG NAG NAG Peptide bridge

A

NAM NAM NAM NAM NAG NAG NAG NAG

NAM NAM NAM NAM NAG NAG NAG NAG

CH2 OH O (NAG) OH CH2 OH O NH O (NAM) OH CH2 OH C= O CH2 OH O O O CH3 (NAM) NH O (NAG) OH OH CH2 OH C= O O NH O O NH CH (NAG) 3 O OH C= O C= O HC CH3 NH CH3 CH3 O C= O C= O H C CH3 L-Alanine CH3 Amino D-Glutamate C= O acid L-Alanine Diaminopimelate chain D-Glutamate D-Alanine Peptide Diaminopimelate bridge D-Alanine B

• Figure 2-14  Peptidoglycan sheet (A) and subunit (B) structure. Multiple peptidoglycan layers compose the murein structure, and different layers are extensively cross-linked by peptide bridges. Note that amino acid chains are only derived from NAM. NAG, N-acetylglucosamine; NAM, N-acetylmuramic acid. (Modified from Saylers AA, Whitt DD: Bacterial pathogenesis: a molecular approach, Washington, DC, 2010, American Society for Microbiology Press.)

Periplasmic Space

The periplasmic space typically is found only in gramnegative bacteria (whether it is present in gram-positive organisms is the subject of debate). The periplasmic space is bounded by the internal surface of the outer membrane and the external surface of the cellular membrane. This area, which contains the murein layer, consists of gel-like substances that assist in the capture of nutrients from the environment. This space also contains several enzymes involved in the degradation of macromolecules and detoxification of environmental solutes, including antibiotics that enter through the outer membrane. Cytoplasmic (Inner) Membrane

The cytoplasmic (inner) membrane is present in both gram-positive and gram-negative bacteria and is the deepest layer of the cell envelope. The cytoplasmic membrane is heavily laced with various proteins, including a number of enzymes vital to cellular metabolism. The cell membrane serves as an additional osmotic barrier and is functionally similar to the membranes of several eukaryotic cellular organelles (e.g., mitochondria, Golgi complexes, lysosomes). The cytoplasmic membrane functions include: • Transport of solutes into and out of the cell • Housing of enzymes involved in outer membrane synthesis, cell wall synthesis, and the assembly and secretion of extracytoplasmic and extracellular substances • Generation of chemical energy (i.e., ATP) • Cell motility • Mediation of chromosomal segregation during replication • Housing of molecular sensors that monitor chemical and physical changes in the environment Cellular Appendages

amino acid chain linked to N-acetylmuramic acid molecules (Figure 2-14). Polymers of these subunits crosslink to one another by means of peptide bridges to form peptidoglycan sheets. In turn, layers of these sheets are cross-linked with one another, forming a multilayered, cross-linked structure of considerable strength. Referred to as the murein sacculus, or sack, this peptidoglycan structure surrounds the entire cell. A notable difference between the cell walls of grampositive and gram-negative bacteria is the substantially thicker peptidoglycan layer in gram-positive bacteria (Figure 2-13). In addition, the cell wall of gram-positive bacteria contains teichoic acids (i.e., glycerol or ribitol phosphate polymers combined with various sugars, amino acids, and amino sugars). Some teichoic acids are linked to N-acetylmuramic acid, and others (e.g., lipoteichoic acids) are linked to the next underlying layer, the cellular or cytoplasmic membrane. Other bacteria (e.g., mycobacteria) have waxy substances within the murein layer, such as mycolic acids. Mycolic acids make the cells more refractory to toxic substances, including acids. Bacteria with mycolic acid in the cell walls require unique staining procedures and growth media in the diagnostic laboratory.

In addition to the components of the cell envelope proper, cellular appendages (i.e., capsules, fimbriae, and flagella) are associated with or proximal to this portion of the cell. The presence of these appendages, which can play a role in the mediation of infection and in laboratory identification, varies among bacterial species and even among strains within the same species. The capsule is immediately exterior to the murein layer of gram-positive bacteria and the outer membrane of gramnegative bacteria. The capsule is composed of high-molecular-weight polysaccharides, the production of which may depend on the environment and growth conditions surrounding the bacterial cell. The capsule does not function as an effective permeability barrier or add strength to the cell envelope, but it does protect bacteria from attack by components of the human immune system. The capsule also facilitates and maintains bacterial colonization of biologic (e.g., teeth) and inanimate (e.g., prosthetic heart valves) surfaces through the formation of “slime layers” or biofilms. Both slime layers and biofilms imply the presence of an extracellular polymer matrix that varies in composition and structure in different organisms. A biofilm may consist of a monomicrobic or polymicrobic group of bacteria housed in a complex biochemical matrix. This extracellular matrix stabilizes the cell to protect the organism from hydrodynamic

CHAPTER 2  Bacterial Genetics, Metabolism, and Structure

forces in the host and plays a protective role against biocides and agents of the host’s immune system. (See Chapter 3 for further discussion of microbial biofilms.) Fimbriae, or pili, are hairlike, proteinaceous structures that extend from the cell membrane into the external environment; some may be up to 2 mm long. Fimbriae may serve as adhesins that help bacteria attach to animal host cell surfaces, often as the first step in establishing infection. In addition, a pilus may be referred to as a sex pilus; this structure, which is well characterized in the gram-negative bacillus E. coli, serves as the conduit for the passage of DNA from the donor to the recipient during conjugation. The sex pilus is present only in cells that produce a protein referred to as the F factor. F-positive cells initiate mating or conjugation only with F-negative cells, thereby limiting the conjugative process to cells capable of transporting genetic material through the hollow sex pilus. Flagella are complex structures, mostly composed of the protein flagellin, that are intricately embedded in the cell envelope. These structures are responsible for bacterial motility. Although not all bacteria are motile, motility plays an important role in survival and the ability of certain bacteria to cause disease. Depending on the bacterial species, flagella may be located at one end of the cell (monotrichous flagella), flagella may be present at both ends of the cell (lophotrichous flagella), a single flagellum may reside at both ends of the cell (amphitrichous flagella), or the entire cell surface may be covered with flagella (peritrichous flagella). The flagellum acts as a rotary motor containing a complex set of rings that act as bushings to control cellular movement. Gram-negative flagella are equipped with a basal body structure that contains five rings, the L-ring that is embedded in the lipid bilayer, the P-ring in the periplasmic space, a smaller S-ring (stator ring) attached to the M-ring or motor ring, and the C-ring, which anchors the entire complex to the cell. Because gram-positive organisms have a much more stable complex cellular structure because of the thick layer of peptidoglycan, the flagella contain only two basal body rings: One is embedded in the peptidoglycan layer, which is very stable, and the second is embedded in the cell membrane.

Cell Interior Those structures and substances that are bound internally by the cytoplasmic membrane compose the cell interior and include the cytosol, polysomes, inclusions, nucleoid, plasmids, and endospores. The cytosol, where nearly all other functions not conducted by the cell membrane occur, contains thousands of enzymes and is the site of protein synthesis. The cytosol has a granular appearance caused by the presence of many polysomes (mRNA complexed with several ribosomes during translation and protein synthesis) and inclusions (i.e., storage reserve granules). The number and nature of the inclusions vary depending on the bacterial species and the nutritional state of the organism’s environment. Two common types of granules include glycogen, a storage form of glucose, and polyphosphate granules, a storage form for inorganic phosphates that are microscopically visible in certain bacteria stained with specific dyes.

23

Unlike eukaryotic chromosomes, the bacterial chromosome is not enclosed within a membrane-bound nucleus. Instead the bacterial chromosome exists as a nucleoid in which the highly coiled DNA is intermixed with RNA, polyamines, and various proteins that lend structural support. At times, depending on the stage of cell division, more than one chromosome may be present per bacterial cell. Plasmids are the other genetic elements that exist independently in the cytosol, and their numbers may vary from none to several hundred per bacterial cell. The final bacterial structure to be considered is the endospore. Under adverse physical and chemical conditions or when nutrients are scarce, some bacterial genera (Bacillus and Clostridium spp.) are able to form spores (i.e., sporulate). Sporulation involves substantial metabolic and structural changes in the bacterial cell. Essentially, the cell transforms from an actively metabolic and growing state to a dormant state, with a decrease in cytosol and a concomitant increase in the thickness and strength of the cell envelope. The endospore remains in a dormant state until favorable conditions for growth are again encountered. This survival tactic is demonstrated by a number of clinically relevant bacteria and complicates thorough sterilization of materials and food for human use.

  Visit the Evolve site for a complete list of procedures, review questions, and case study answers.

Bibliography Bennett J, Dolin R, and Blaser M: Principles and practice of infectious diseases, ed 8, Philadelphia, PA, 2015, Elsevier-Saunders. Brock TD, Madigan M, Martinko J, et al, editors: Biology of microorganisms, Upper Saddle River, NJ, 2009, Prentice Hall. Goodrich JA, Kugel JF: From bacteria to humans, chromatin to elongation, and activation to repression: the expanding roles of noncoding RNAs in regulating transcription, Crit Rev Biochem Mol Biol 44:3-15, 2009. Joklik WK, Willett H, Amos B, et al, editors: Zinsser microbiology, Norwalk, CT, 1992, Appleton & Lange. Krebs JE, Goldstein ES, Kilpatrick ST: Lewin’s genes X, Sandbury, MA, 2011, Jones and Bartlett Learning. Moat AG, Foster JW: Microbial physiology, New York, 2002, Wiley-Liss. Neidhardt FC, Ingraham JL, Schaecter M, editors: Physiology of the bacterial cell: a molecular approach, Sunderland, MA, 1990, Sinauer Associates. Nuss AM, Heroven AK, Waldmann B, et al: Transcriptomic profiling of Yersinia pseudotuberculosis reveals programming of the Crp regulon by temperature and uncovers Crp as a master regulator of small RNAs. PLOS Genetics 11:1-26, 2015. Ryan KJ, editor: Sherris medical microbiology: an introduction to infectious diseases, Norwalk, CT, 2003, McGraw-Hill Medical. Saylers AA, Wilson BA, Whitt DD, Winkler ME: Bacterial pathogenesis: a molecular approach, Washington, DC, 2010, American Society for Microbiology Press. Schomburg D, Gerhard M: Biochemical pathways: an atlas of biochemistry and molecular biology, ed 2, New York, 2012, Wiley. Stortchevoi A, Varshney U, RajBhandary UL: Common location of determinants in initiator transfer RNAs for initiator-elongator discrimination in bacteria and in eukaryotes, J Biol Chem 278(20):17672, 2003. Zhurina MV, Gannesen AV, Zdorovenko EL, Plakunov VK: Composition and functions of the extracellular polymer matrix of bacterial biofilms, Microbiology 83:713-722, 2014.

3

Host-Microorganism Interactions OBJECTIVES 1. List the various reservoirs (environments) that facilitate host-microorganism interactions. 2. Define direct versus indirect transmission and provide examples of each. 3. Define and differentiate the interactions between the host and microorganism, including colonization, infection, microbiota, microbiome, pathogens, opportunistic pathogens, and nosocomial infection. 4. List and describe the components involved in specific versus nonspecific immune defenses, including inflammation, phagocytosis, antibody production, and cellular responses. 5. Identify elements involved in the two arms of the immune system: humoral and cell-mediated immunity. 6. Provide specific examples of disease prevention strategies, including preventing transmission, controlling reservoirs, and minimizing risk of exposure. 7. Differentiate between bacterial endotoxins and exotoxins and provide examples of each. 8. Given a patient history of an infectious process, identify and differentiate a sign versus a symptom. 9. Define and differentiate between an acute infectious process and one that is chronic and/or latent. 10. Describe the three major steps in the formation of a microbial biofilm and list the advantages of biofilm formation to the microorganism and the disadvantages to the infected host.

I

nteractions between humans and microorganisms are exceedingly complex and far from being completely understood. What is known about the interactions between these two living entities plays an important role in the practice of diagnostic microbiology and in the management of infectious disease. Understanding these interactions is necessary for establishing methods to reliably isolate specific microorganisms from patient specimens and for developing effective treatment strategies. This chapter provides the framework for understanding the various aspects of host-microorganism interactions. Box 3-1 lists a variety of terms and definitions associated with hostmicroorganism interactions. Host-microorganism interactions should be viewed as bidirectional in nature. Humans use the abilities and natural

24

products of microorganisms in various settings, including the food and fermentation industry, as biologic insecticides for agriculture; to genetically engineer a multitude of products; and even for biodegrading industrial waste. However, microbial populations share the common goal of survival with humans, using their relationship with humans for food, shelter, and dissemination, and they have been successful at achieving those goals. Which participant in the relationship is the user and which is the used is a fine and intricate balance of nature. This is especially true when considering the microorganisms most closely associated with humans and human disease. In 2007, the National Institutes of Health initiated a project referred to as the Human Microbiome Project (http:// commonfund.nih.gov/hmp/index). The human microbiome consists of microorganisms that are present in and on the human body at any given time without causing harm. The initial development of the microbiome project focused on four major goals: (1) determining whether a core human microbiome exists; (2) determining whether changes in the human microbiome correlate with health and disease; (3) developing new technology and bioinformatic tools to manage the project data; and (4) addressing the ethical, legal, and social implications associated with the microbiome project. Interestingly, the study has elucidated that the microbiome complex ecosystem varies significantly across the body and between individuals. Analysis of the human microbiome has demonstrated that it is clearly an emergent property. Interestingly, studies have indicated that it is possible to detect life-long effects of various factors on the microbiome, such as whether or not an individual was breastfed as an infant. There are also gender studies that indicate men and women have different communities of skin microbiota. Undoubtedly, this research will continue to evolve and potentially provide insight into the characterization, risk, and prevention of disease in different communities and during different stages of life. The relationship between host and pathogen is ultimately a balance between the normal human microbiome and the appearance of a potentially infectious agent. The complex relationships between human hosts and medically relevant microorganisms are best understood by

CHAPTER 3  Host-Microorganism Interactions

• BOX 3-1

25

Definitions of Selected Epidemiologic Terms

Carrier: A person who harbors the etiologic agent but shows no apparent signs or symptoms of infection or disease Common source: A single source or reservoir from which an etiologic agent responsible for an epidemic or outbreak originates Disease incidence: The number of new diseases or infected persons in a population Disease prevalence: The percentage of diseased persons in a given population at a particular time Endemic: A disease constantly present at some rate of occurrence in a particular location Epidemic: A larger-than-normal number of diseased or infected individuals in a particular location Etiologic agent: A microorganism responsible for causing infection or infectious disease Health care–associated infection: Infections acquired as a result of a medical procedure, such as insertion of a central line, catheter, or ventilator, or as a result of participation or admission into a health care facility Microbiome: An individual’s microbiologic environment, present in or on the human host Mode of transmission: The means by which etiologic agents are brought in contact with the human host (e.g., infected blood, contaminated water, insect bite) Morbidity: The state of disease and its associated effects on the host

Physical encounter between host and microorganism

Microorganism colonization of host surface(s)

Microorganism entry, invasion, and dissemination

Outcome

• Figure 3-1  ​General stages of microbial-host interaction.

considering the sequential steps in the development of microbial-host associations and the subsequent development of infection and disease. The stages of interaction (Figure 3-1) include (1) the physical encounter between the host and microorganism; (2) colonization or survival of the microorganism on an internal (gastrointestinal, respiratory, or genitourinary tract) or external (skin) surface of the host; (3) microbial entry, invasion, and dissemination to deeper

Morbidity rate: The incidence of a particular disease state Mortality: Death resulting from disease Mortality rate: The incidence in which a disease results in death Nosocomial infection: Infection for which the etiologic agent was acquired in a hospital or long-term health care center or facility Outbreak: A larger than normal number of diseased or infected individuals that occurs over a relatively short period Pandemic: An epidemic that spans the world Reservoir: The origin of the etiologic agent or location from which it disseminates (e.g., water, food, insects, animals, other humans) Strain typing: Laboratory-based characterization of etiologic agents designed to establish their relatedness to one another during a particular outbreak or epidemic Surveillance: Any type of epidemiologic investigation that involves data collection for characterizing circumstances surrounding the incidence or prevalence of a particular disease or infection Vector: A living entity (animal, insect, or plant) that transmits the etiologic agent Vehicle: A nonliving entity that is contaminated with the etiologic agent and as such is the mode of transmission for that agent

tissues and organs of the human body; and (4) resolution or outcome.

The Encounter Between Host and Microorganism The Human Host’s Perspective Because microorganisms are found everywhere, human encounters are inevitable, but the means of encounter vary widely. Which microbial population a human is exposed to and the mechanism of exposure are often direct consequences of a person’s activity or behaviors. Certain activities carry different risks for an encounter, and there is a wide spectrum of activities and situations over which a person may or may not have absolute control. For example, acquiring salmonellosis because one fails to cook the holiday turkey thoroughly is avoidable, whereas contracting tuberculosis as a consequence of living in conditions of extreme poverty and overcrowding may be unavoidable. The role that human activities play in the encounter between humans and microorganisms cannot be overstated, because most of the crises associated with infectious disease could be prevented or greatly reduced if human behavior and living conditions could be altered.

Microbial Reservoirs and Transmission Humans encounter microorganisms when they enter or are exposed to the same environment in which the microbial agents live or when the infectious agents are brought to the human host by indirect means. The environment, or place

26 PA RT I  Basic Medical Microbiology

Microorganism sources (reservoirs) Humans Animals Food (from plant and animal sources) Water Air Soil

Modes of transmission

1. Direct; transmitted by direct contact between reservoir and host 2. Indirect; transmitted to host via intervening agent(s)

Human host

Intervening agents: Vectors — animals, insects, other humans Vehicles — water, food, air, medical devices, various other inanimate objects

• Figure 3-2  ​Summary of microbial reservoirs and modes of transmission to humans.

of origin, of the infecting agent is referred to as the reservoir. As shown in Figure 3-2, microbial reservoirs include humans, animals, water, food, air, and soil. The human host may acquire microbial agents by various means, referred to as the modes of transmission. The mode of transmission is direct when the host directly contacts the microbial reservoir and is indirect when the host encounters the microorganism by an intervening agent of transmission. The agents of transmission that bring the microorganism from the reservoir to the host may be a living entity, such as an insect, in which case they are called vectors, or they may be a nonliving entity, referred to as a vehicle or fomite. In addition, some microorganisms may have a single mode of transmission, whereas others may spread by various methods. From a diagnostic microbiology perspective, knowledge about an infectious agent’s mode of transmission is often important for determining optimal specimens for isolation of the organism and for implementing precautions that minimize the risk of laboratory or health care–associated infections (see Chapters 4, 78, and 79 for more information regarding laboratory safety, infection control, and sentinel laboratory responses, respectively).

Human and Microbe Interactions Humans play a substantial role as microbial reservoirs. In fact, the passage of a neonate from the sterile environment of the mother’s womb through the birth canal, which is heavily colonized with various microbial agents, is a primary example of one human directly (i.e., direct transmission) acquiring a microorganism from another human serving as the reservoir. This is the mechanism by which newborns first encounter microbial agents. Other examples in which humans serve as the microbial reservoir include the acquisition of streptococcal pharyngitis through touching; hepatitis through blood transfusions; gonorrhea, syphilis, and acquired immunodeficiency syndrome (AIDS) through sexual contact; tuberculosis through coughing; and the common cold through

sneezing. Indirect transmission can occur when microorganisms from one individual contaminate a vehicle of transmission, such as water (e.g., cholera), that is then ingested by another person. In the medical setting, indirect transmission of microorganisms from one human host to another by means of contaminated medical devices helps disseminate infections in hospitals. Hospital-acquired, health care—associated, or long-term care—associated infections historically are referred to as nosocomial infections. Because of the changing demographics of health care, health care–associated infections include exposure in a variety of settings that are not confined to in-patient care within a traditional health care institution. These exposures occur during field containment or transportation of infectious agents as well as in daily contact with infected patients in clinics. In addition, health care–associated infections are not confined to health care professionals and patients, but also include visitors, support staff, and students.

Animals as Microbial Reservoirs Infectious agents from animal reservoirs can be transmitted directly to humans through an animal bite (e.g., rabies) or indirectly through the bite of insect vectors that feed on both animals and humans (e.g., Lyme disease and Rocky Mountain spotted fever). Animals may also transmit infectious agents by acquiring them from or depositing them in water and food supplies. For example, beavers are often heavily colonized with parasites that cause infection of the human gastrointestinal tract. These parasites may be encountered and subsequently acquired when stream water becomes contaminated by the beaver and is used by a vacationing camper. Alternatively, animals used for human food carry numerous bacteria (e.g., Salmonella and Campylobacter) that, if not destroyed through appropriate cooking during preparation, can cause severe gastrointestinal illness. Many other infectious diseases are encountered through direct or indirect animal contact, and information regarding

CHAPTER 3  Host-Microorganism Interactions

a patient’s exposure to animals is often a key component in the diagnosis of these infections. Some microorganisms primarily infect animal populations and on occasion accidentally encounter and infect humans. When a human infection results from such an encounter, it is referred to as a zoonotic infection.

Insects as Vectors The most common role of insects (arthropods) in the transmission of infectious disease is as vectors rather than as reservoirs. A wide variety of arthropods transmit viral, parasitic, and bacterial disease from animals to humans, whereas others transmit microorganisms between human hosts without an intermediate animal reservoir. Malaria, a deadly disease, is a prime example of an infectious disease maintained in the human population by the feeding and survival of an insect vector, the mosquito. Still other arthropods may themselves be agents of disease. These include organisms such as lice and scabies, which are spread directly between humans and cause skin irritations but do not penetrate the body. Because they are able to survive on the skin of the host without gaining access to internal tissues, they are referred to as ectoparasites. In addition, nonfungal infections (e.g., tetanus) may result when microbial agents in the environment, such as endospores, are mechanically introduced by the vector as a result of a bite, scratch, or other penetrating wound.

The Environment as a Microbial Reservoir The soil and natural environmental debris are reservoirs for countless types of microorganisms. Therefore it is not surprising that these also serve as reservoirs for microorganisms that can cause infection in humans. Many of the fungal agents (see Part V: Mycology) are acquired by inhalation of soil and dust particles containing microorganisms (e.g., San Joaquin Valley fever). Other, nonfungal infections (e.g., tetanus endospores) may result when microbial agents in the environment are introduced into the human body as a result of a penetrating wound.

The Microorganism’s Perspective Clearly, numerous activities can result in human encounters with microorganisms. Because humans are engaged in all of life’s complex activities, the tendency is to perceive the microorganism as having a passive role in the encounter process. However, this assumption is a gross oversimplification. Microorganisms are also driven by survival, and the environment of the reservoirs they occupy must allow their metabolic and genetic needs to be fulfilled. Reservoirs may be inhabited by hundreds or thousands of different species of microorganisms. Yet human encounters with the reservoirs, either directly or indirectly, do not result in all species establishing an association with the human host. Although some species have evolved strategies that do not require a human host to ensure survival, others have included humans to a lesser or greater extent as part of their survival

27

tactics. Therefore these organisms often have mechanisms that enhance their chances for a human encounter. Depending on factors associated with both the human host and the microorganism involved, the encounter may have a beneficial, disastrous, or inconsequential effect on each of the participants.

Microorganism Colonization of Host Surfaces The Host’s Perspective Once a microbe attains contact with a human host, the outcome of the encounter depends on what happens during each step of the interaction (Figure 3-1), beginning with colonization. The human host’s role in microbial colonization, defined as the persistent survival of microorganisms on a surface of the human body, is dictated by the defenses that protect vital internal tissues and organs against microbial invasion. The first defenses are the external and internal body surfaces that are in direct contact with the external environment and are the anatomic regions where the microorganisms will initially come in contact with the human host. These surfaces include: • Skin (including the conjunctival epithelium covering the eye) • Mucous membranes lining the mouth or oral cavity, the respiratory tract, the gastrointestinal tract, and the genitourinary tract Because body surfaces are always present and provide protection against all microorganisms, skin and mucous membranes are considered constant and nonspecific defense mechanisms. As is discussed later in this text, other protective mechanisms are produced in response to the presence of microbial agents (inducible defenses), and some are directed specifically at particular microorganisms (specific defense mechanisms).

Skin and Skin Structures Skin serves as a physical and chemical barrier to microorganisms; its protective characteristics are summarized in Table 3-1 and Figure 3-3. The acellular, outermost layer of the skin, along with the tightly packed cellular layers underneath, provides an impenetrable physical barrier to all microorganisms, unless damaged. In addition, these layers continuously shed, thus dislodging bacteria that have attached to the outer layers. The skin is also a dry and cool environment, which is incompatible with the growth requirements of many microorganisms that thrive in a warm, moist environment. The follicles and glands of the skin produce various natural antibacterial substances, including sebum and sweat. However, many microorganisms can survive the conditions of the skin. These bacteria, or the skin microbiome, are known as skin colonizers, and they often produce substances that may be toxic and inhibit the growth of more harmful microbial agents. Recent studies have demonstrated that the skin

28 PA RT I  Basic Medical Microbiology

microbiome differs among healthy individuals more than any other body site. Beneath the outer layers of skin are various host cells that protect against organisms that breach the surface barriers. These cells, collectively known as skin-associated lymphoid tissue, mediate specific and nonspecific responses directed at controlling microbial invaders. TABLE Protective Characteristics of the Skin 3-1 and Skin Structures

Skin Structure

Protective Activity

Outer (dermal) layers

• Act as a physical barrier to microbial penetration • Remove attached bacteria through sloughing of the outer layers • Provide dry, acidic, and cool conditions that limit bacterial growth

Hair follicles, sweat glands, sebaceous glands

• Produce acids, alcohols, and toxic lipids that limit bacterial growth

Eyes/conjunctival epithelium

• Flushing action of tears: removes microorganisms • Lysozyme in tears: destroys the bacterial cell wall • Mechanical blinking of the eyelid: removes microorganisms

Skin-associated lymphoid tissue

• Mediates specific and nonspecific protection mechanisms against microorganisms that penetrate the outer tissue layers

Because cells that line the respiratory tract, gastrointestinal tract, and genitourinary tract are involved in numerous functions besides protection, they are not covered with a hardened, acellular layer as is the skin surface. However, the cells that compose these membranes still exhibit various protective characteristics (Table 3-2 and Figure 3-4). TABLE Protective Characteristics of Mucous 3-2 Membranes

Mucous Membrane

Hair

Protective Activity

Mucosal cells

• Rapid sloughing for bacterial removal • Tight intercellular junctions: prevent bacterial penetration

Goblet cells

• Mucus production: Protective lubrication of cells; bacterial trapping; contains specific antibodies with specific activity against bacteria • Provision of antibacterial substances to mucosal surface: • Lysozyme (degrades bacterial cell wall) • Lactoferrin (competes for bacterial iron supply) • Lactoperoxidase (production of substances toxic to bacteria)

Mucosa-associated lymphoid tissue

• Mediates specific responses against bacteria that penetrate the outer layer

Goblet cell Intercellular (mucus production) junctions

Sweat pore

Environment Bacteria

Mucous Membranes

Dead Epidermis layer Cellular layer Duct Dermis

Sebaceous gland

Sweat gland Hair follicle

Deeper tissues and internal organs

• Figure 3-3  ​Skin and skin structures.

Cell sloughing Subcutaneous tissue (hypodermis)

Ciliated cell

External

• Figure 3-4  ​General

Bacteria trapped in mucus ball

features of mucous membranes, highlighting the protective features such as ciliated cells, mucus production, tight intercellular junctions, and cell sloughing.

CHAPTER 3  Host-Microorganism Interactions

General Protective Characteristics

Mucus is a major protective component of the membranes. This substance serves to trap bacteria before they can reach the outer surface of the cells, lubricates the cells to prevent damage that promotes microbial invasion, and contains specific chemical (i.e., antibodies) and nonspecific antibacterial substances. In addition to the chemical properties and physical movement of the mucus and trapped microorganisms mediated by ciliary action, rapid cellular shedding and tight intercellular connections provide effective barriers to infection. As is the case with the skin, specific cell clusters, known as mucosa-associated lymphoid tissue, exist below the outer cell layer and mediate specific protective mechanisms against microbial invasion. Specific Protective Characteristics

Besides the general protective properties of mucosal cells, the mucosal linings throughout the body have characteristics specific to each anatomic site (Figure 3-5). The mouth, or oral cavity, is protected by the flow of saliva that physically carries microorganisms away from cell surfaces and also contains antibacterial substances, such as antibodies (IgA) and lysozyme that participate in the destruction of bacterial cells. The mouth is also heavily colonized with protective microorganisms that produce substances that hinder successful invasion by harmful organisms. In the gastrointestinal tract, the low pH and proteolytic (protein-digesting) enzymes of the stomach prevent the

growth of many microorganisms. In the small intestine, protection is provided through the presence of bile salts, which disrupt bacterial membranes, and by peristaltic movement and the fast flow of intestinal contents, which hinder microbial attachment to mucosal cells. Although the large intestine also contains bile salts, the movement of bowel contents is slower, permitting a higher concentration of microbial agents the opportunity to attach to the mucosal cells and inhabit the gastrointestinal tract. As in the oral cavity, the high concentration of normal microbial inhabitants in the large bowel also contributes significantly to protection. In the upper respiratory tract, nasal hairs keep out large airborne particles that may contain microorganisms. The cough-sneeze reflex significantly contributes to the removal of potentially infective agents. The cells lining the trachea contain cilia (hairlike cellular projections) that move microorganisms trapped in mucus upward and away from the delicate cells of the lungs (Figure 3-4); this is referred to as the mucociliary escalator. These barriers are so effective that only inhalation of particles smaller than 2 to 3 mm have a chance of reaching the lungs. In the female urogenital tract, the vaginal lining and the cervix are protected by heavy colonization with normal microbial inhabitants and a low pH. A thick mucus plug in the cervical opening is a substantial barrier that keeps microorganisms from ascending and invading the more delicate tissues of the uterus, uterine tubes, and ovaries. The anterior

Nasopharynx Resident microflora Secretions (lysozyme, phagocytes) Ciliated cells

Mouth Sloughing cells Flow of saliva Lysozyme Resident microflora Lungs Macrophages

High concentration of resident microflora

Stomach Low pH Proteolytic enzymes Vagina Low pH Resident microflora

Small intestine Fast flow Mucus Sloughing cells Bile salts Peristalsis Colon Slow flow Mucus, sloughing cells Abundant resident microflora Bile salts Peristalsis

• Figure 3-5  ​Protective surfaces.

29

Bladder Flushing action of urine Low pH Physical barrier of urethra Urethra Urine flow

characteristics associated with the mucosal linings of different internal body

30 PA RT I  Basic Medical Microbiology

urethra of males and females is naturally colonized with microorganisms, and a stricture at the urethral opening provides a physical barrier that, combined with a low urine pH and the flushing action of urination, protects against bacterial invasion of the bladder, ureters, and kidneys.

The Microorganism’s Perspective As previously discussed, microorganisms that inhabit many surfaces of the human body (Figure 3-5) are referred to as colonizers, normal flora, normal microbiota, and collectively as the human microbiome. Some are transient colonizers, because they are able to survive, but do not multiply, on the surface and are frequently shed with the host cells. Others, called resident microbiota, not only survive but also thrive and multiply; their presence is more persistent. The body’s microbiota varies considerably with anatomic location. For example, environmental conditions, such as temperature and oxygen availability, differ considerably between the nasal cavity and the small bowel. Only microorganisms with the metabolic capability to survive under the physiologic conditions of the anatomic location are inhabitants of those particular body surfaces. Knowledge of the microbiota of the human body is extremely important in diagnostic microbiology, especially for determining the clinical significance of microorganisms isolated from patient specimens. Organisms considered normal microbiota are commonly found in clinical specimens. This may be a result of contamination of normally sterile specimens during the collection process or because the colonizing organism is actually involved in the infection. Microorganisms considered as normal colonizers of the human body and the anatomic locations they colonize are addressed in Part VII.

Microbial Colonization Colonization may be the last step in the establishment of a long-lasting, mutually beneficial (i.e., commensal) or harmless relationship between a colonizer and the human host. Alternatively, colonization may be the first step in the process for the development of infection and disease. Whether colonization results in a harmless or damaging infection depends on the characteristics of the host and the microorganism. In either case, successful initial colonization depends on the microorganism’s ability to survive the conditions first encountered on the host surface (Box 3-2). To avoid the dryness of the skin, organisms often seek moist areas of the body, including hair follicles, sebaceous (oil, referred to as sebum) and sweat glands, skin folds, underarms, the genitals or anus, the face, the scalp, and areas around the mouth. Microbial penetration of mucosal surfaces is mediated by the organism becoming embedded in food particles to survive oral and gastrointestinal conditions or contained within airborne particles to aid survival in the respiratory tract. Microorganisms also exhibit metabolic capabilities that assist in their survival. For example, the ability of staphylococci to thrive in relatively high salt

• BOX 3-2

Microbial Factors That Contribute to Colonization of Host Surfaces

Survival Against Environmental Conditions • Localization in moist areas • Protection in ingested or inhaled debris • Expression of specific metabolic characteristics (e.g., salt tolerance)

Achieving Attachment and Adherence to Host Cell Surfaces • • • •

Pili Adherence proteins Biofilms Various protein adhesins

Other Factors • Motility • Production of substances that compete with the host for acquisition of essential nutrients (e.g., siderophores to capture iron) • Ability to coexist with other colonizing microorganisms

concentrations enhances their survival in and among the sweat glands of the skin. Besides surviving the host’s physical and chemical conditions, colonization also requires that microorganisms attach and adhere to host surfaces (Box 3-2). This can be particularly challenging in places such as the mouth and bowel, in which the surfaces are frequently flushed with passing fluids. Pili, the rodlike projections of bacterial envelopes; various molecules (e.g., adherence proteins and adhesins); and biochemical complexes (e.g., biofilm) work together to enhance attachment of microorganisms to the host cell surface. Biofilm is discussed in more detail later in this chapter. (For more information concerning the structure and functions of pili, see Chapter 2.) In addition, microbial motility with flagella allows organisms to move around and actively seek optimum conditions. Finally, because no single microbial species is a lone colonizer, successful colonization also requires that a microorganism be able to coexist with other microorganisms.

Microorganism Entry, Invasion, and Dissemination The Host’s Perspective In most instances, to establish infection, microorganisms must penetrate or circumvent the host’s physical barriers (i.e., skin or mucosal surfaces); overcoming these defensive barriers depends on both host and microbial factors. When these barriers are broken, numerous other host defensive strategies are activated.

Disruption of Surface Barriers Any situation that disrupts the physical barrier of the skin and mucosa, alters the environmental conditions (e.g., loss

CHAPTER 3  Host-Microorganism Interactions

of stomach acidity or dryness of the skin), changes the functioning of surface cells, or alters the normal microbiota, facilitates the penetration of microorganisms past the barriers and into deeper host tissues. Disruptive factors may vary from accidental or intentional (medical) trauma that results in surface destruction to the use of antibiotics that remove normal, protective, colonizing microorganisms (Box 3-3). Notably, a number of these factors are related to medical interventions and procedures. • BOX 3-3

Factors That Contribute to the Disruption of the Skin and Mucosal Surface

Bacteria

Nucleus

Responses to Microbial Invasion of Deeper Tissues Once surface barriers have been bypassed, the host responds to a microbial presence in the underlying tissue in various ways. Some of these responses are nonspecific, because they occur regardless of the type of invading organism; other responses are more specific and involve the host’s immune system. Both nonspecific and specific host responses are critical if the host is to survive. Without them, microorganisms would multiply and invade vital tissues and organs, resulting in severe damage to the host. Nonspecific Responses

Some nonspecific responses are biochemical; others are cellular. Biochemical factors remove essential nutrients, such as iron, from tissues so that it is unavailable for use by invading microorganisms. Cellular responses are central to tissue and organ defenses, and the cells involved are known as phagocytes.

Trauma • Penetrating wounds • Abrasions • Burns (chemical and fire) • Surgical wounds • Needle sticks Inhalation • Noxious or toxic gases • Particulate matter • Smoking Implantation of Medical Devices Other Diseases • Malignancies • Diabetes • Previous or simultaneous infections • Alcoholism and other chemical dependencies Childbirth Overuse of Antibiotics

Endocytosis

Phagocytes

Phagocytes are cells that ingest and destroy bacteria and other foreign particles. The types of phagocytes are polymorphonuclear leukocytes, also known as neutrophils (PMNs), macrophages, and dendritic cells. Phagocytes ingest bacteria by a process known as endocytosis and engulf them in a membrane-lined structure called a phagosome (Figure 3-6). The phagosome is then fused with a second structure, the lysosome. When the lysosome, which contains toxic chemicals and destructive enzymes, combines with the phagosome, the bacteria trapped within the structure, referred to as a

Phagosome–lysosome fusion

Phagosome

Lysosomes Phagocyte

Phagolysosome In phagolysosome, there is release of lysozyme and other toxic substances Outcomes

Bacterial fragments 1 Long-term survival of bacteria in phagocyte

31

2 Bacterial destruction

3 Destruction of phagocyte

• Figure 3-6  ​Overview of phagocyte activity and possible outcomes of phagocyte-bacterial interactions.

32 PA RT I  Basic Medical Microbiology

phagolysosome, are neutralized and destroyed. This destructive process must be carried out inside membrane-lined structures; otherwise the noxious substances contained within the phagolysosome would destroy the phagocyte itself. This is evident during the course of rampant infections when thousands of phagocytes exhibit “sloppy” ingestion of the microorganisms and toxic substances spill from the cells, damaging the surrounding host tissue. The two major phagocytes, PMNs and macrophages, differ in viability and anatomic distribution. PMNs develop in the bone marrow and spend their short lives (usually a day or less) circulating in blood and tissues. Widely dispersed in the body, PMNs usually are the first cells on the scene of bacterial invasion. Macrophages also develop in the bone marrow. Macrophages circulating in the bloodstream are called monocytes. When deposited in tissue or at a site of infection, monocytes transform into mature macrophages. In the absence of infection, macrophages usually reside in specific organs, such as the spleen, lymph nodes, liver, or lungs, where they live for days to several weeks, awaiting encounters with invading bacteria. In addition to the ingestion and destruction of bacteria, macrophages play an important role in mediating immune system defenses (see Specific Responses—The Immune System later in this chapter). In addition to the inhibition of microbial proliferation by phagocytes and by biochemical substances such as lysozyme, microorganisms are “washed” from tissues during the flow of lymph fluid. The fluid carries infectious agents through the lymphatic system, where they are deposited in tissues and organs (e.g., lymph nodes and the spleen) heavily populated with phagocytes. This process functions as an efficient filtration system. Inflammation

Because microbes may survive initial encounters with phagocytes (Figure 3-6), the inflammatory response plays an extremely important role as a primary mechanism against microbial survival and proliferation in tissues and organs. Inflammation has both cellular and biochemical components that interact in various complex ways (Table 3-3). The complement system is composed of a coordinated group of proteins activated by the immune system or as a result of the presence of invading microorganisms. On activation of this system, a cascade of biochemical events occurs that attracts (chemotaxis) and enhances the activities of phagocytes. Because PMNs and macrophages are widely dispersed throughout the body, signals are needed to attract and concentrate these cells at the point of invasion, and serum complement proteins provide many of these signals. Cytokines are chemical substances, or proteins secreted by a cell, that have effects on the activities of other cells. Cytokines draw more phagocytes toward the infection and activate the maturation of monocytes to macrophages. Additional protective functions of the complement system are enhanced by hemostasis, which works to increase blood flow to the area of infection and also can effectively

TABLE Components of Inflammation 3-3

Component

Functions

Phagocytes (polymorphonuclear neutrophils [PMNs], dendritic cells, and macrophages)

• Ingest and destroy microorganisms

Complement system (coordinated group of serum proteins)

• Attracts phagocytes to the site of infection (chemotaxis) • Helps phagocytes recognize and bind to bacteria (opsonization) • Directly kills gramnegative bacteria (membrane attack complex)

Coagulation system (wide variety of proteins and other biologically active compounds)

• Attracts phagocytes to the site of infection • Increases blood and fluid flow to the site of infection • Walls off the site of infection, physically inhibiting the spread of microorganisms

Cytokines (proteins secreted by macrophages and other cells)

• Multiple effects that enhance the activities of many different cells essential to nonspecific and specific defensive responses

wall off the infection through the production of blood clots and barriers composed of cellular debris. The manifestations of inflammation are readily evident and are familiar to most adults; they include the following: • Swelling—caused by an increased flow of fluid and cells to the affected body site • Redness—results from vasodilation of blood vessels and increased blood flow at the infection site • Heat—results from increased cellular metabolism and energy production in the affected area • Pain—caused by tissue damage and pressure on nerve endings from an increased flow of fluid and cells On a microscopic level, the presence of phagocytes at the infection site is an important observation in diagnostic microbiology. Microorganisms associated with these host cells are frequently identified as the cause of a particular infection. An overview of inflammation is depicted in Figure 3-7.

CHAPTER 3  Host-Microorganism Interactions

Coagulation system

Complement system

Heavy chain

Variable regions (antigen binding sites)

Phagocytes

33

V Light chain

Fab fragment Constant regions

Cytokines FC fragment

Inflammation (swelling, redness, heat, pain) 1. Attract cells and biochemical mediators of defense 2. Facilitate removal of infectious agents by lymphatic system 3. Wall off and limit extension of invasion 4. Supplement and interact with immune system defenses

• Figure 3-7  ​Overview

of the components, signs, and functions of

inflammation.

Specific Responses—The Immune System The immune system provides the human host with the ability to mount a specific protective response to the presence of the invading microorganism. In addition to this specificity, the immune system has a “memory.” When a microorganism is encountered a second or third time, an immune-mediated defensive response is immediately available. However, nonspecific (i.e., phagocytes, inflammation) and specific (i.e., the immune system) host defensive systems are interdependent in their efforts to limit the spread of infection. Components of the Immune System

The central molecule of the immune response is the antibody. Antibodies, also referred to as immunoglobulins, are specific glycoproteins produced by plasma cells (activated B cells) in response to the presence of a molecule recognized as foreign to the host (referred to as an antigen). In the case of infectious diseases, antigens are chemicals or toxins secreted by the invading microorganism or components of the organism’s structure and are usually composed of proteins or polysaccharides. Antibodies circulate in the plasma or liquid portion of the host’s blood and are present in secretions such as saliva. These molecules have two active areas: the antigen binding site (Fab region) and the phagocyte and complement binding sites (Fc region) (Figure 3-8). Five major classes of antibody have been identified: IgG, IgA, IgM, IgD, and IgE. Each class has distinctive molecular configurations. IgM is the largest and first antibody produced when an invading microorganism is initially encountered; production of the most abundant antibody, IgG, follows. IgA is secreted in various body fluids (e.g., saliva and tears) and

Complement binding site Phagocyte binding site

• Figure 3-8  ​General structure of the IgG-class antibody molecule.

primarily protects body surfaces lined with mucous membranes. Increased IgE is associated with parasitic infections and allergies. IgD is attached to the surface of specific immune system cells and is involved in the regulation of antibody production. As is discussed in Chapter 9 the ability to measure specific antibody production is a valuable tool for the laboratory diagnosis of infectious diseases. Regarding the cellular components of the immune response, there are three major types of cells: B lymphocytes, T lymphocytes, and natural killer cells (Box 3-4). B lymphocytes originate from stem cells and develop into B cells in the bone marrow before being widely distributed to lymphoid tissues throughout the body. These cells primarily function as antibody producers (plasma cells). T lymphocytes also originate from bone marrow stem cells, but they mature in the thymus and either directly destroy infected cells (cytotoxic T cells) or work with B cells (helper T cells) to regulate antibody production. T-regulatory cells (Tregs) suppress autoimmune responses by other T lymphocytes and mediate immune tolerance. Natural killer cells are a subset of T cells. There are different types of natural killer cells, with the most prevalent referred to as invariant natural killer T (NKT) cells. NKT cells develop in the thymus from the same precursor cells as other T lymphocytes. NKT cells have a limited repertoire of T cell receptors that respond to synthetic, bacterial, and fungal glycolipids. NKT cells are also activated by the release of cytokines during viral infections. Each of the three cell types is strategically located in lymphoid tissue throughout the body to maximize the chances of encountering invading microorganisms that the lymphatic system drains from the site of infection. Two Branches of the Immune System

The immune system provides immunity that generally can be divided into two branches: • Antibody-mediated immunity, or humoral immunity • Cell-mediated immunity, or cellular immunity Antibody-mediated immunity is centered on the activities of B cells and the production of antibodies. When B

34 PA RT I  Basic Medical Microbiology

• BOX 3-4

Cells of the Immune System

B Lymphocytes (B Cells) Location: Lymphoid tissues (lymph nodes, spleen, gutassociated lymphoid tissue, tonsils) Function: Antibody-producing cells Subtypes: B lymphocytes: Cells waiting to be stimulated by an antigen Plasma cells: Activated B lymphocytes that secrete antibody in response to an antigen B-memory cells: Long-living cells preprogrammed to an antigen for subsequent exposure

T Lymphocytes (T Cells) Location: Circulate and reside in lymphoid tissues (lymph nodes, spleen, gut-associated lymphoid tissue, tonsils) Functions: Multiple (see different subtypes) Subtypes: Helper T cells (TH): Interact with B cells to facilitate antibody production Cytotoxic T cells (TC): Recognize and destroy host cells that have been invaded by microorganisms Suppressor T cells (TS): Mediate regulatory responses within the immune system

Antigen receptor + Microbial antigens

B cell

B-cell activation 1. Clonal expansion = multiplication of B cells that specifically recognize antigen that stimulated activation

2. Antigen is taken into B cell, processed, and presented on B-cell surface, which attracts helper T cells

Natural Killer Cells (NK Cells) Function: Similar to that of cytotoxic T cells but do not require the presence of an antigen to stimulate function

cells encounter a microbial antigen, they become activated, and a series of events is initiated. These events are mediated by the activities of helper T cells and the release of cytokines. Cytokines mediate clonal expansion, and the number of B cells capable of recognizing the antigen increases. Cytokines also activate the maturation of B cells into plasma cells that produce antibodies specific for the antigen. The process results in the production of B memory cells (Figure 3-9). B memory cells remain quiescent in the body until a second (anamnestic) or subsequent exposure to the original antigen occurs. With secondary exposure, the B memory cells are preprogrammed to produce specific antibodies immediately upon encountering the original antigen. Antibodies protect the host in a number of ways: • Helping phagocytes to ingest and kill microorganisms through a coating mechanism, referred to as opsonization • Neutralizing microbial toxins that are detrimental to host cells and tissues • Promoting bacterial clumping (agglutination) that facilitates clearing from the infection site • Inhibiting bacterial motility • Viral neutralization; blocking the virus from entering the host cell • Combining with microorganisms to activate the complement system and inflammatory response Because a population of activated specific B cells is a developmental process that results from exposure to microbial antigens, antibody production is delayed when the host is first exposed to an infectious agent. This delay in the

3. Activated helper T cells, in turn, stimulate B cells to undergo maturation to plasma cells for: - Increased production of highly specific antibody - Switching from IgM to IgG antibody production - Production of B-memory cells

• Figure 3-9  Overview of B cell activation, which is central to antibodymediated immunity.

primary antibody response underscores the importance of nonspecific response defenses, such as inflammation, that work to hold the invading organisms in check while antibody production begins. This also emphasizes the importance of B memory cell production. By virtue of this memory, any subsequent exposure or secondary antibody response (anamnestic) to the same microorganism results in rapid production of protective antibodies so that the body is spared the delays characteristic of the primary exposure. Some antigens, such as bacterial capsules and outer membranes, activate B cells to produce antibodies without the intervention of helper T cells. However, this activation does not result in the production of B memory cells, and subsequent exposure to the same bacterial antigens does not result in a rapid host memory response. The primary cells involved in cell-mediated immunity are T lymphocytes (cytotoxic T cells) that recognize and destroy human host cells infected with microorganisms. This function is extremely important for the destruction and elimination of infecting microorganisms. Some pathogens (e.g., viruses, tuberculosis, some parasites, and fungi) are able to survive in host cells, protected from antibody

CHAPTER 3  Host-Microorganism Interactions

interaction. Antibody-mediated immunity targets microorganisms outside human cells, whereas cell-mediated immunity targets microorganisms inside human cells. However, in many instances, these two branches of the immune system overlap and work together. Like B cells, T cells must be activated. Activation is accomplished by T-cell interactions with other cells that process microbial antigens and present them on their surface (e.g., macrophages, dendritic cells, and B cells). The responses of activated T cells are very different and depend on the subtype of T cell (Figure 3-10). Activated helper T cells work with B cells for antibody production (Figure 3-9) and facilitate inflammation by releasing cytokines. Cytotoxic T cells directly interact with and destroy host cells containing microorganisms or other infectious agents, such as viruses. The activated T cell subset, helper or cytotoxic cells, is controlled by an extremely complex series of biochemical pathways and genetic diversity within the major histocompatibility complex (MHC). MHC molecules are present on cells and form a complex with the antigen to present them to the T cells. The two primary classes of major histocompatibility molecules are MHC I and MHC II. MHC I molecules are

Antigen receptor

Antigens

T lymphocytes - Helper T cells - Cytotoxic T cells

Antigen-presenting cells - Macrophages - B lymphocytes - Dendritic cells

35

located on every nucleated cell in the body and are predominantly responsible for the recognition of endogenous proteins expressed from within the cell. MHC II molecules are located on specialized cell types, including macrophages, dendritic cells, and B cells, for the presentation of extracellular molecules or exogenous proteins. In summary, the host presents a spectrum of challenges to invading microorganisms, from physical barriers, including the skin and mucous membranes, to the interactive cellular and biochemical components of inflammation and the immune system. All these systems work together to minimize microbial invasion and prevent damage to vital tissues and organs resulting from the presence of infectious agents.

The Microorganism’s Perspective Given the complexities of the human host’s defense systems, it is no wonder that microbial strategies designed to survive these systems are equally complex.

Colonization and Infection Many human body surfaces are colonized with a wide variety of microorganisms or microbiota without apparent detriment. In contrast, an infection involves the growth and multiplication of microorganisms that result in damage to the host. The extent and severity of the damage depend on many factors, including the microorganism’s ability to cause disease, the site of the infection, and the general health of the individual infected. Disease results when the infection produces notable changes in human physiology associated with damage or loss of function to one or more of the body’s organ systems.

Pathogens and Virulence

Activation

Activated helper T cells: - Increased in number - Release cytokines that stimulate activities of phagocytes, natural killer cells, and other components of inflammation - Assist B cells in antibody production (see Figure 3-9) or Activated cytotoxic T cells: - Increased in number - Target and destroy host cells that are infected with microorganisms

• Figure 3-10  ​Overview mediated immunity.

of T cell activation, which is central to cell-

Microorganisms that cause infections or disease are called pathogens, and the characteristics that enable them to cause disease are referred to as virulence factors. Most virulence factors protect the organism against host attack or mediate damaging effects on host cells. The terms pathogenicity and virulence reflect the degree to which a microorganism is capable of causing disease. Pathogenicity specifically refers to the organism’s ability to cause disease, whereas virulence refers to the measure or degree of pathogenicity of an organism. An organism of high pathogenicity is very likely to cause disease, whereas an organism of low pathogenicity is much less likely to cause infection. When disease does occur, highly virulent organisms often severely damage the human host. The degree of severity decreases with diminishing virulence of the microorganism. Because host factors play a role in the development of infectious diseases, the distinction between a pathogenic and nonpathogenic organism or colonizer is not always clear. For example, many organisms that colonize the skin usually do not cause disease (i.e., exhibit low pathogenicity) under normal circumstances. However, when damage to the skin occurs (Box 3-3) or when the skin is disrupted in some

36 PA RT I  Basic Medical Microbiology

other way, these organisms can gain access to deeper tissues and establish an infection. Organisms that cause infection when one or more of the host’s defense mechanisms are disrupted or malfunction are known as opportunistic pathogens, and the infections they cause are referred to as opportunistic infections. On the other hand, several pathogens known to cause serious infections can be part of an individual’s microbiome and never cause disease. However, the same organism can cause life-threatening infection when transmitted to other individuals. The reasons for these inconsistencies are not fully understood, but such widely different results undoubtedly involve complex interactions between microorganism and human. Recognizing and separating a pathogenic from a nonpathogenic organism present one of the greatest challenges in interpreting diagnostic microbiology laboratory results.

Microbial Virulence Factors Virulence factors provide microorganisms with the capacity to avoid host defenses and damage host cells, tissues, and organs in a number of ways. Some virulence factors are specific for certain pathogenic genera or species, and substantial differences exist in the way bacteria, viruses, parasites, and fungi cause disease. Knowledge of a microorganism’s capacity to cause specific types of infections plays a major role in the development of diagnostic microbiology procedures used for isolating and identifying microorganisms. (See Part VII for more information regarding diagnosis by organ system.) Attachment

Whether humans encounter microorganisms in the air, through ingestion, or by direct contact, the first step of infection and disease development, a process referred to as pathogenesis, is microbial attachment to a surface (exceptions being instances in which the organisms are directly introduced by trauma or other means into deeper tissues). Many of the microbial factors that facilitate attachment of pathogens are the same as those used by nonpathogenic colonizers (Box 3-2). Most pathogenic organisms are not part of the normal human microbiota, and attachment to the host requires that they outcompete the microbiota for a place on the body’s surface. Medical interventions, such as the overuse of antimicrobial agents, result in the destruction of the normal microbiota, creating a competitive advantage for the invading pathogenic organism. Invasion.

Once surface attachment has been secured, microbial invasion into subsurface tissues and organs (i.e., infection) is accomplished by disruption of the skin and mucosal surfaces by several mechanisms (Box 3-3) or by the direct action of an organism’s virulence factors. Some microorganisms produce factors that force mucosal surface phagocytes (M cells) to ingest them and then release them unharmed into the tissue below the surface. Other organisms, such as

staphylococci and streptococci, are not so subtle. These organisms produce an array of enzymes (e.g., hyaluronidases, nucleases, collagenases) that hydrolyze host proteins and nucleic acids, destroying host cells and tissues. This destruction allows the pathogen to “burrow” through minor openings in the outer surface of the skin and into deeper tissues. Once a pathogen has penetrated the body, it uses a variety of strategies to survive attack by the host’s inflammatory and immune responses. Alternatively, some pathogens cause disease at the site of attachment without further penetration. For example, in diseases such as diphtheria and whooping cough, the bacteria produce toxic substances that destroy surrounding tissues. The organisms generally do not penetrate the mucosal surface they inhabit. Survival Against Inflammation

If a pathogen is to survive, the action of phagocytes and the complement components of inflammation must be avoided or controlled (Box 3-5). Some organisms, such as Streptococcus pneumoniae, a common cause of bacterial pneumonia and meningitis, avoid phagocytosis by producing a large capsule that inhibits the phagocytic process. Other pathogens may not be able to avoid phagocytosis but are not effectively destroyed once internalized and are able to survive within phagocytes. This is the case for Mycobacterium tuberculosis, the bacterium that causes tuberculosis. Still other pathogens use toxins and enzymes to attack and destroy phagocytes before the phagocytes attack and destroy them. The defenses offered by the complement system depend on a series of biochemical reactions triggered by specific microorganism molecular structures. Therefore microbial • BOX 3-5

Microbial Strategies for Surviving Inflammation

Avoid Killing by Phagocytes (Polymorphonuclear Leukocytes) • Producing a capsule, thereby inhibiting phagocytes’ ability to ingest them

Avoid Phagocyte-Mediated Killing • Inhibiting phagosome-lysosome fusion • Being resistant to destructive agents (e.g., lysozyme) released by lysosomes • Actively and rapidly multiplying within a phagocyte • Releasing toxins and enzymes that damage or kill phagocytes

Avoid Effects of the Complement System • Using a capsule to hide surface molecules that would otherwise activate the complement system, including the formation of a complex protein polysaccharide matrix (biofilm) • Producing substances that inhibit the processes involved in complement activation • Producing substances that destroy specific complement proteins

CHAPTER 3  Host-Microorganism Interactions

avoidance of complement activation requires that the infecting agent either mask its activating molecules (e.g., via production of a capsule that covers bacterial surface antigens) or produce substances (e.g., enzymes) that disrupt critical biochemical components of the complement pathway. Any single microorganism may possess numerous virulence factors, and several may be expressed simultaneously. For example, while trying to avoid phagocytosis, an organism may also excrete other enzymes and toxins that destroy and penetrate tissue and produce other factors designed to interfere with the immune response. Microorganisms may also use host systems to their own advantage. For example, the lymphatic and circulatory systems used to carry monocytes and lymphocytes to the site of infection may also serve to disperse the organism throughout the body. Survival Against the Immune System

Microbial strategies to avoid the defenses of the immune system are outlined in Box 3-6. Again, a pathogen can use more than one strategy to avoid immune-mediated defenses, and microbial survival does not necessarily require devastation of the immune system. The pathogen may merely need to “buy” time to reach a safe area in the body or to be transferred to the next susceptible host. Also, microorganisms can avoid much of the immune response if they do not penetrate the surface layers of the body. This strategy is the hallmark of diseases caused by microbial toxins. Microbial Toxins

Toxins are biochemically active substances released by microorganisms that have a particular effect on host cells. Microorganisms use toxins to establish infections and multiply within the host. Alternatively, a pathogen may be restricted to a particular body site from which toxins are released to cause systemic damage throughout the body. Toxins also can cause

• BOX 3-6

Strategies That Microbial Pathogens Use to Survive the Immune Response

• Rapid invasion and multiplication resulting in damage to the host before the immune response can be fully activated, or organism’s virulence is so great that the immune response is insufficient • Invasion and destruction of cells involved in the immune response • Survival in host cells and avoiding detection by the immune system • Masking the organism’s antigens with a capsule or biofilm so that an immune response is not activated • Altering the expression and presentation of antigens so that the immune system is constantly fighting a primary encounter (i.e., the memory of the immune system is neutralized) • Production of enzymes (proteases) that directly destroy or inactivate antibodies

37

human disease in the absence of the pathogens that produced them. This common mechanism of food poisoning involves ingestion of preformed bacterial toxins (present in the food at the time of ingestion) and is referred to as intoxication, a notable example of which is botulism. Endotoxin and exotoxin are the two general types of bacterial toxins (Box 3-7). Endotoxin is a component of the cellular structure of gram-negative bacteria and can have devastating effects on the body’s metabolism, the most serious being endotoxic shock, which often results in death. The effects of exotoxins produced by gram-positive bacteria tend to be more limited and specific than the effects of gram-negative endotoxin. The activities of exotoxins range from enzymes produced by many staphylococci and streptococci that augment bacterial invasion by damaging host tissues and cells to highly specific activities (e.g., diphtheria toxin inhibits protein synthesis, and cholera toxin interferes with host cell signals). Examples of other highly active and specific toxins are those that cause botulism and tetanus by interfering with neuromuscular functions.

Genetics of Virulence: Pathogenicity Islands Many virulence factors are encoded in genomic regions of pathogens known as pathogenicity islands (PAIs). These are mobile genetic elements that contribute to the change and spread of virulence factors among bacterial populations of a variety of species. These genetic elements are believed to

• BOX 3-7

Summary of Bacterial Toxins

Endotoxins • General toxin common to almost all gram-negative bacteria • Composed of the lipopolysaccharide portion of cell envelope • Released when a gram-negative bacterial cell is destroyed • Effects on host include: • Disruption of clotting, causing clots to form throughout the body (i.e., disseminated intravascular coagulation [DIC]) • Fever • Activation of complement and immune systems • Circulatory changes that lead to hypotension, shock, and death

Exotoxins • Most commonly associated with gram-positive bacteria • Produced and released by living bacteria; do not require bacterial death for release • Specific toxins target specific host cells; the type of toxin varies with the bacterial species • Some kill host cells and help spread bacteria in tissues (e.g., enzymes that destroy key biochemical tissue components or specifically destroy host cell membranes) • Some destroy or interfere with specific intracellular activities (e.g., interruption of protein synthesis, interruption of internal cell signals, or interruption of the neuromuscular system)

38 PA RT I  Basic Medical Microbiology

have evolved from lysogenic bacteriophages and plasmids and are spread by horizontal gene transfer (see Chapter 2 for information about bacterial genetics). PAIs typically comprise one or more virulence-associated genes and “mobility” genes (i.e., integrases and transposases) that mediate movement between various genetic elements (e.g., plasmids and chromosomes) and among different bacterial strains. In essence, PAIs facilitate the dissemination of virulence capabilities among bacteria in a manner similar to the mechanism diagrammed in Figure 2-10; this also facilitates dissemination of antimicrobial resistance genes (Chapter 10). PAIs are widely disseminated among medically important bacteria. For example, PAIs have been identified as playing a role in virulence for each of the following organisms: Helicobacter pylori Pseudomonas aeruginosa Shigella spp. Yersinia spp. Vibrio cholerae Salmonella spp. Escherichia coli (enteropathogenic, enterohemorrhagic or serotoxigenic, verotoxigenic, uropathogenic, enterotoxigenic, enteroinvasive, enteroaggregative, meningitissepsis associated; Chapter 19) Neisseria spp. Bacteroides fragilis Listeria monocytogenes Staphylococcus aureus Streptococcus spp. Enterococcus faecalis Clostridium difficile Biofilm Formation

Microorganisms typically exist as a group or community of organisms capable of adhering to each other or to other surfaces. A variety of bacterial pathogens, along with other microorganisms, are capable of forming biofilms, including S. aureus, P. aeruginosa, and Candida albicans. A biofilm is an accumulation of microorganisms embedded in a polysaccharide matrix. Pathogenic microorganisms use the formation of biofilm to adhere to implants and prosthetic devices. For example, health care acquired infections with Staphylococci spp. associated with implants have become more prevalent. Interestingly, biofilmforming strains have a much more complex antibiotic resistance profile, indicating failure of the antibiotic to penetrate the polysaccharide layer. In addition, some of the cells in a sessile or stationary biofilm may experience nutrient deprivation and therefore exist in a slow-growing or starved state, displaying reduced susceptibility to antimicrobial agents. These organisms also have demonstrated a differential gene expression compared with their planktonic or free-floating counterparts. The biofilmforming communities are able to adapt and respond to changes in their environment, similar to a multicellular organism.

Biofilms may form from the accumulation of a single microorganism (monomicrobic aggregation) or from the accumulation of numerous species (polymicrobic aggregation). The initial stage in biofilm formation begins with the synthesis of an extracellular polymer matrix accompanied by aggregation and recognition. This process is facilitated by the formation of polysaccharides, proteins, and extracellular DNA. The formation of the biofilm protects the organism from desiccation, forms a barrier against toxic compounds, and prevents the loss of protective organic and inorganic molecules. Once the initial biofilm has developed, a process which takes approximately 4 to 6 hours, depending on the growth rate of the microorganism, maturation of the biofilm occurs. This includes the complex formation of a three-dimensional architecture, including pores and channels within the polymer matrix. It is widely accepted that the cells in a biofilm are physiologically unique from the planktonic cells and are referred to as persister cells. During biofilm accumulation, the cells reach a critical mass that results in alteration in metabolism and gene expression. This is accomplished through a mechanism of signaling between cells or organisms through chemical signals or inducer molecules, such as acyl homoserine lactone (AHL) in gram-negative bacteria or oligopeptides in gram-positive bacteria. These signals are capable of interspecies and intraspecies communication. In addition, the formation of a complex polymicrobial biofilm provides favorable conditions for the exchange of genetic information and horizontal gene transfer. Microbial biofilm formation is important to many disciplines, including environmental science, industry, and public health. Biofilm formation affects the efficient treatment of wastewater; it is essential for the effective production of beer, which requires aggregation of yeast cells; and it affects bioremediation for toxic substances such as oil. It has been reported that approximately 65% of hospital-acquired infections are associated with biofilm formation. Box 3-8 provides an overview of pathogenic

• BOX 3-8

Biofilms and Human Infections

These pathogenic organisms have been associated with biofilm formation in human infections.

Artificial Prosthetics and Indwelling Devices • • • • • • •

Candida albicans Coagulase-negative staphylococci Enterococcus spp. Klebsiella pneumoniae Pseudomonas aeruginosa Staphylococcus aureus Streptococcus spp.

Food-Borne Contamination • Listeria monocytogenes

CHAPTER 3  Host-Microorganism Interactions

Host factors: - General state of health - Integrity of surface defenses - Capacity for inflammatory and immune response - Level of immunity - Impact of medical intervention

Restoration of host to complete health

Potential outcome

Restoration of host to health with residual effects

39

Microbial factors: - Level of virulence - Number of organisms introduced into host - Body sites pathogen targets for invasion

Survival with host’s health severely compromised

Death

Full spectrum of outcomes

• Figure 3-11  Possible outcomes of infections and infectious diseases.

organisms associated with biofilm formation in human infections.

Outcome and Prevention of Infectious Diseases Outcome of Infectious Diseases Given the complexities of host defenses and microbial virulence, it is not surprising that the factors determining outcome between these two living entities are also complicated. Basically, outcome depends on the state of the host’s health, the virulence of the pathogen, and whether the host can clear the pathogen before infection and disease cause irreparable harm or death (Figure 3-11). The time from exposure to an infectious agent and the development of a disease or infection depends on host and microbial factors. Infectious processes that develop quickly are referred to as acute infections, and those that develop and progress slowly, sometimes over a period of years, are known as chronic infections. Some pathogens, particularly certain viruses, can be clinically silent inside the body without any noticeable effect on the host before suddenly causing a severe and acute infection. During the silent phase, the infection is said to be latent. Again, depending on host and microbial factors, acute, chronic, or latent infections can result in any of the outcomes detailed in Figure 3-11. Medical intervention can help the host fight the infection but usually is not instituted until after the host is aware that an infectious process is underway. The clues that an infection is occurring are known as the signs and symptoms of disease and result from host responses (e.g., inflammatory and immune responses) to the action of microbial virulence factors (Box 3-9). Signs are measurable indications or physical observations, such as an increase in body temperature (fever) or the development of a rash or swelling. Symptoms are indictors as described by the patient, such as headache, aches, fatigue, and nausea. The signs and symptoms reflect

• BOX 3-9 • • • • • • • • • • • •

Signs and Symptoms of Infection and Infectious Diseases

General or localized aches and pains Headache Fever Fatigue Swollen lymph nodes Rashes Redness and swelling Cough and sneezes Congestion of nasal and sinus passages Sore throat Nausea and vomiting Diarrhea

the stages of infection. In turn, the stages of infection generally reflect the stages in host-microorganism interactions (Figure 3-12). Whether medical procedures contribute to controlling or clearing an infection depends on key factors, including: • The severity of the infection, which is determined by the host and microbial interactions already discussed • Accuracy in diagnosing the pathogen or pathogens causing the infection • Whether the patient receives appropriate treatment for the infection (which depends on accurate diagnosis)

Prevention of Infectious Diseases The treatment of an infection is often difficult and not always successful. Because much of the damage may already have been done before appropriate medical intervention is provided, the microorganisms gain too much of a “head start.” Another strategy for combating infectious diseases is to stop infections before they start (i.e., disease prevention). As discussed at the beginning of this chapter, the first step in any host-microorganism relationship is the encounter and

40 PA RT I  Basic Medical Microbiology

Host-microorganism interactions Encounter and entry

Colonization and entry

Invasion and dissemination

Pathogen encounters and colonizes host surface

Pathogen multiplies and breaches host surface defenses

Pathogen invades deeper tissues and disseminates, encounters inflammatory and immune responses

Outcome Pathogen completes cycle: — Leaves host — Destroys host — Remains in latent state — Is destroyed by host

Corresponding infection-disease stages Incubation stage

Prodromal stage

Clinical stage

Stage of decline

Convalescent stage

No signs or symptoms

First signs and symptoms, pathogen may be highly communicable

Peak of characteristic signs and symptoms of infection or disease

Condition of host deteriorates possibly to death or signs and symptoms begin to subside as host condition improves

Full recovery of surviving host or chronic infection develops, or death

• Figure 3-12  ​Host-microorganism interactions and stages of infection or disease.

• BOX 3-10 Strategies for Preventing Infectious

Diseases

Preventing Transmission • Avoid direct contact with infected persons or take protective measures when direct contact will occur (e.g., wear gloves, wear condoms). • Block the spread of airborne microorganisms by wearing masks or isolating persons with infections transmitted by air. • Use sterile medical techniques.

Controlling Microbial Reservoirs • • • • •

Sanitation and disinfection Sewage treatment Food preservation Water treatment Control of pests and insect vector populations

Minimizing Risk Before or Shortly After Exposure • Immunization or vaccination • Cleansing and use of antiseptics • Prophylactic use of antimicrobial agents

exposure to the infectious agent. Therefore strategies to prevent disease involve interrupting or minimizing the risk of infection when exposures occur. As outlined in Box 3-10, interruption of encounters may be accomplished by preventing transmission of the infecting agents and by controlling or destroying reservoirs of human pathogens. Interestingly, most of these measures do not really involve medical practices but rather social practices and policies.

Immunization Medical strategies exist for minimizing the risk of disease development when exposure to infectious agents occurs. One of the most effective methods is vaccination, also referred to as immunization. This practice takes advantage of the specificity and memory of the immune system. The two basic approaches to immunization are active immunization and passive immunization. With active immunization, modified antigens from pathogenic microorganisms are introduced into the body and cause an immune response. If or when the host encounters the pathogen in nature, the memory of the immune system ensures minimal delay in the immune response, thus affording strong protection. With passive immunization, antibodies against a particular pathogen that have been produced in one host are transferred to a second host, where they provide temporary protection. The passage of maternal antibodies to the newborn is a key example of natural passive immunization. Active immunity is generally longer lasting, because the immunized host’s own immune response has been activated. However, for complex reasons, naturally acquired active immunity has had limited success for relatively few infectious diseases, necessitating the development of vaccines. Successful immunization has proven effective against many infectious diseases, including diphtheria, whooping cough (pertussis), tetanus, influenza, polio, smallpox, measles, hepatitis, and certain Streptococcus pneumoniae and Haemophilus influenzae infections. Prophylactic antimicrobial therapy, the administration of antibiotics when the risk of developing an infection is high, is another common medical intervention for preventing infection.

CHAPTER 3  Host-Microorganism Interactions

Epidemiology To prevent infectious diseases, information is required regarding the sources of pathogens, the mode of transmission to and among humans, human risk factors for encountering the pathogen and developing infection, and factors that contribute to good and bad outcomes resulting from the exposure. Epidemiology is the science that characterizes these aspects of infectious diseases and monitors the effect diseases have on public health. Fully characterizing the circumstances associated with the acquisition and dissemination of infectious diseases gives researchers a better chance of preventing and eliminating the diseases. In addition, many epidemiologic strategies developed for use in public health systems also apply in long-term care facilities (e.g., nursing homes, hospitals, assisted-living centers) for the control of health care–associated infections (i.e., nosocomial infections; for more information on infection control, see Chapter 79. The field of epidemiology is broad and complex. Diagnostic microbiology laboratory personnel and epidemiologists

CASE STUDY 3-1 An 8-year-old boy presents to the emergency department (ED) with right upper abdominal pain associated with vomiting, headache, and fever. The boy had been seen in the ED approximately 1.5 months previously for a sore throat, cough, and headache. After the first visit to the ED, the patient was treated with amoxicillin. The boy was born in northern Africa in a refugee camp. He and his family had emigrated from Africa approximately 8 months ago. Generally the boy appears to be in good health. His immunizations are current, and he has no allergies. He currently resides with his parents and three siblings, who all appear to be in good health. His mother speaks very little English. The attending physician orders an abdominal computed tomography (CT) scan and identifies a mass in the left hepatic lobe. There appears to be no evidence of gastrointestinal bleeding. The attending physician orders a complete workup on the patient, including a complete blood count, microbiology tests, chemistry, coagulation, and a hepatitis panel. The laboratory results indicate some type of infection and inflammatory condition. The patient has an elevated white blood cell (WBC) count that correlates with his erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP) level. The ESR and the CRP level are clear indicators of an inflammatory process.

Questions 1. Identify and differentiate the patient’s signs and symptoms. 2. Explain whether this patient likely has an acute or a chronic infection.

41

often work closely to investigate problems. Therefore familiarity with certain epidemiologic terms and concepts is important (Box 3-1). Because the central focus of epidemiology is on tracking and characterizing infections and infectious diseases, this field depends heavily on diagnostic microbiology. Epidemiologic investigations cannot proceed unless researchers first know the etiologic or causative agents. Therefore the procedures and protocols used in diagnostic microbiology to detect, isolate, and characterize human pathogens are essential for patient care and also play a central role in epidemiologic studies focused on disease prevention and the general improvement of public health. In fact, microbiologists who work in clinical laboratories are often the first to recognize patterns that suggest potential outbreaks or epidemics. Visit the Evolve site for a complete list of procedures, review questions, and case study answers.

Bibliography Atlas RM: Principles of microbiology, St Louis, 2006, Mosby. Bennett J, Dolin R, Blaser M: Principles and practice of infectious diseases, ed 8, Philadelphia, 2015, Elsevier Saunders. Brock TD, Madigan M, Martinko J, et al, editors: Biology of microorganisms, Upper Saddle River, NJ, 2009, Prentice Hall. Ding T, Scholoss PD: Dynamics and associations of microbial community types across the human body, Nature 509:357, 2014. Dobrindt U: Genomic islands in pathogenic and environmental microorganisms, Nat Rev Microbiol 2:414, 2002. Engleberg NC, DiRita V, Dermody TS: Schaechter’s mechanisms of microbial disease, Baltimore, Md, 2007, Lippincott Williams & Wilkins. Hu T, Gimferrer I, Alberola-Ila J: Control of early stages in invariant natural killer T-cell development, Immunology 134:1-7, 2011. Jorgensen J, Pfaller M, Carroll K, et al: Manual of clinical microbiology, ed 11, Washington, DC, 2015, ASM Press. Karunakaran E, Mukherjee J, Ramalingam B, Biggs CA: Biofilmology: a multidisciplinary review of the study of microbial biofilms, Appl Microbiol Biotechnol 90:1869, 2011. Simões LC, Lemos M, Pereira AM, et al: Persister cells in a biofilm treated with a biocide, Biofouling 27:4, 403, 2011. Murray PR, editor: Medical microbiology, ed 5, St Louis, 2008, Mosby. Ryan KJ, editor: Sherris medical microbiology: an introduction to infectious diseases, Norwalk, Conn, 2003, McGraw-Hill Medical. Schmidt H, Hensel M: Pathogenicity islands in bacterial pathogenesis, Clin Microbiol Rev 17:14, 2004. Zhurina MV, Gannesen AV, Zdorovenko EL, Plakunov VK: Composition and functions of the extracellular polymer matrix of bacterial biofilms, Microbiology 83:713, 2014.

PART I I  General Principles in Clinical Microbiology SECTION 1   Safety and Specimen Management

4

Laboratory Safety OBJECTIVES 1. Define and differentiate sterilization, disinfection, decontamination, and antiseptic. 2. List the factors that influence the effectiveness of disinfectants in the microbiology laboratory. 3. Describe the methods used for the disposal of hazardous waste, including physical and chemical methods, and the material and/or organisms effectively eliminated by each method. 4. Define a chemical hygiene plan and describe the purpose of the methods and items that are elements of the plan, including proper labeling of hazardous materials, training programs, and material safety data sheets. 5. Name the four types of fire extinguishers and the specific flammables that each is effective in controlling. 6. Describe the process of Universal or Standard Precautions in the microbiology laboratory, including handling of infectious materials, personal hygiene, use of personal protective equipment, handling of sharp objects, and hand-washing procedures. 7. Define Biosafety Levels 1 through 4, including the precautions required for each, and identify a representative organism for each. 8. Outline the basic guidelines for packing and shipping infectious substances. 9. Describe the management and response required during a biologic or chemical exposure incident in the laboratory.

M

icrobiology laboratory safety practices were first published in 1913. They included admonitions such as the necessity to (1) wear gloves, (2) wash hands after working with infectious materials, (3) disinfect all instruments immediately after use, (4) use water to moisten specimen labels rather than the tongue, (5) disinfect all contaminated waste before discarding, and (6) report to appropriate personnel all accidents or exposures to infectious agents. These guidelines are still incorporated into safety programs in the diagnostic microbiology laboratory. Safety programs have been expanded to include the proper handling of biologic hazards encountered in processing patient specimens and handling infectious microorganisms; fire and 42

electrical safety; the safe handling, storage, and disposal of chemicals and radioactive substances; and techniques for safely lifting or moving heavy objects. In areas of the country prone to natural disasters (e.g., earthquakes, hurricanes, snowstorms), safety programs include disaster preparedness plans that outline the steps to take in an emergency. Although all microbiologists are responsible for their own health and safety, the institution and supervising personnel are required to provide safety training to familiarize microbiologists with known hazards in the workplace and to prevent exposure. Laboratory safety is considered an integral part of overall laboratory services, and federal law in the United States mandates preemployment safety training, followed by quarterly safety in-services. Safety training regulations are enforced by the United States Department of Labor Occupational Safety and Health Administration (OSHA). Regulations and requirements may vary based on the type of laboratory and updated regulations. It is recommended that the laboratory review these requirements as outlined by OSHA (www.osha.gov). Microbiologists should be knowledgeable, properly trained, and equipped with the proper protective materials and working controls while performing duties in the laboratory. Investigation of the causes of accidents indicates that unnecessary exposures to infectious agents occur when individuals become sloppy in performing their duties or when they deviate from standardized safety precautions.

Sterilization, Disinfection, and Decontamination Sterilization is a process that kills all forms of microbial life, including bacterial endospores. Disinfection is a process that destroys pathogenic organisms, but not necessarily all microorganisms, endospores, or prions. However, some disinfectants will kill endospores with prolonged exposure times. Decontamination is the removal of pathogenic microorganisms so items are safe to handle or dispose of. Many factors limit the success or degree of sterilization, disinfection, or decontamination in a health care setting, such as organic load (organisms and other contaminating

CHAPTER 4  Laboratory Safety

materials such as blood or body fluids), the type of organisms present, the concentration and exposure time to the germicide, the physical and chemical nature of the surface (hinges, cracks, rough or smooth surfaces), temperature, pH, humidity, and presence of a biofilm. These processes may be accomplished by a variety of physical or chemical methods.

Methods of Sterilization The physical methods of sterilization include: • Incineration • Moist heat • Dry heat • Filtration • Ionizing (gamma) radiation • Chemicals (ethylene oxide gas, hydrogen peroxide gas plasma, vaporized hydrogen peroxide, and other liquid chemicals) Incineration is a method of treating infectious waste. Hazardous material is literally burned to ashes at temperatures of 870° to 980°C. Incineration is the safest method to ensure that no infective materials remain in samples or containers when disposed. Prions, infective proteins, are not eliminated using conventional methods. Therefore incineration is recommended. Toxic air emissions and the presence of heavy metals in ash have limited the use of incineration in the United States. Moist heat (steam under pressure) is used to sterilize biohazardous trash and heat-stable objects; an autoclave is used for this purpose. An autoclave is essentially a large pressure

cooker. Moist heat in the form of saturated steam under 1 atmosphere (15 pounds per square inch [psi]) of pressure causes the irreversible denaturation of enzymes and structural proteins. The most commonly used steam sterilizer in the microbiology laboratory is the gravity displacement autoclave (Figure 4-1). Steam enters at the top of the sterilizing chamber; because steam is lighter than air, it displaces the air in the chamber and forces it out the bottom through the drain vent. The two common sterilization temperatures are 121°C and 132°C. Biologic waste that includes broth or solid media is usually autoclaved for 30 minutes at 121°C in a displacement sterilizer or 4 minutes at 132°C in a prevac­ uum sterilizer. Infectious medical waste containing body fluids or blood, on the other hand, is often sterilized at 132°C for 30 to 60 minutes to allow penetration of the steam throughout the waste and the displacement of air trapped inside the autoclave bag. Prions require a much more extensive sterilization process. Several options are recommended for the removal of prions from surgical instruments or other laboratory materials contaminated with high risk tissue such as brain, spinal cord, and eye tissue. According to the eighth edition of Principles and Practices of Infectious Diseases (Elsevier, 2015), there are four options for sterilization: (1) autoclave at 134°C for 18 minutes in a prevacuum sterilizer; (2) autoclave at 132°C for 1 hour in a gravity displacement sterilizer; (3) immerse in 1 N sodium hydroxide for 1 hour, remove and rinse with water, then autoclave at 121°C in a gravity displacement or 134°C in a prevacuum sterilizer for 1 hour; or (4) immerse in 1 N sodium hydroxide for 1 hour and heat in a gravity displacement at 121°C for 30 minutes, then clean and subject to routine equipment

Steam from jacket to chamber

Steam to jacket Jacket

Jacket

Chamber wall

Outer shell Heat exchanger

Chamber drain screen Water supply Drain

A • Figure 4-1  Gravity

B

43

Water/steam ejector

displacement type of autoclave. A, Typical Eagle Century Series sterilizer for laboratory applications. B, Typical Eagle 3000 sterilizer piping diagram. The arrows show the entry of steam into the chamber and the displacement of air. (Courtesy AMSCO International, a subsidiary of STERIS Corp., Mentor, Ohio.)

44 PA RT I I  General Principles in Clinical Microbiology

sterilization. Moist heat is the fastest and simplest physical method of sterilization. Dry heat requires longer exposure times (1.5 to 3 hours) and higher temperatures than moist heat (160° to 180°C). Dry heat ovens are used to sterilize items such as glassware, oil, petrolatum, or powders. Filtration is the method of choice for antibiotic solutions, toxic chemicals, radioisotopes, vaccines, and carbohydrates, which are all heat sensitive. Filtration of liquids is accomplished by pulling the solution through a cellulose acetate or cellulose nitrate membrane with a vacuum. Filtration of air is accomplished using highefficiency particulate air (HEPA) filters designed to remove organisms larger than 0.3 mm from isolation rooms, operating rooms, and biologic safety cabinets (BSCs). The ionizing radiation used in microwaves and radiograph machines is composed of short wavelength and high energy gamma rays. Ionizing radiation is used for sterilizing disposables such as plastic syringes, catheters, or gloves before use. The most common chemical sterilant is ethylene oxide (EtO), which is used in gaseous form for sterilizing heat-sensitive objects. The main disadvantages of EtO use are the lengthy cycle times and the potential health hazards it produces. Vapor-phase hydrogen peroxide (an oxidizing agent) has been used to sterilize HEPA filters in BSCs, metals, and nonmetal devices such as medical instruments (e.g., scissors). There are no toxic byproducts produced using vapor-phase hydrogen peroxide. Hydrogen peroxide gas plasma is another method that uses hydrogen peroxide and generates plasma by exciting the gas in an enclosed chamber under deep vacuum with the use of radiofrequency or microwave energy.

Methods of Disinfection Physical Methods of Disinfection The three physical methods of disinfection are: • Boiling at 100°C for 15 minutes, which kills vegetative bacteria • Pasteurizing at 70°C for 30 minutes, which kills food pathogens without damaging the nutritional value or flavor • Using nonionizing radiation such as ultraviolet (UV) light UV rays are long wavelength and low energy. They do not penetrate well, and organisms must have direct surface exposure, such as the working surface of a BSC, for this form of disinfection to work.

Chemical Methods of Disinfection Chemical disinfectants comprise many classes, including: • Alcohols • Aldehydes • Halogens (chlorine and chlorine compounds) • Peracetic acid • Hydrogen peroxide • Quaternary ammonium compounds • Phenolics Chemicals used to destroy all life are called chemical sterilants, or biocides; however, these same chemicals,

when used for shorter periods, act as disinfectants. Disinfectants used on living tissue (skin) are called antiseptics. Resistance to disinfectants varies with the type of microorganism. Bacterial endospores, such as Bacillus spp., are the most resistant, followed by mycobacteria (acid-fast bacilli); nonenveloped viruses (e.g., poliovirus); fungi; vegetative (nonsporulating) bacteria (e.g., gram-negative rods), and enveloped viruses (e.g., herpes simplex virus), which are the most susceptible to the action of disinfectants. The Environmental Protection Agency (EPA) registers chemical disinfectants used in the United States and requires manufacturers to specify the activity level of each compound at the working dilution. Therefore microbiologists who must recommend appropriate disinfectants should check the manufacturer’s cut sheets (product information) for the classes of microorganisms that will be killed. Generally, the time necessary for killing microorganisms increases in direct proportion to the microbial load (number of organisms). This is particularly true of instruments contaminated with organic material such as blood, pus, or mucus. The organic material should be mechanically removed before chemical sterilization to decrease the microbial load. This is analogous to removing dried food from utensils before placing them in a dishwasher, and it is important for cold sterilization of instruments such as bronchoscopes. The type of water and its concentration in a solution are also important. Hard water may reduce the rate of killing of microorganisms. In addition, 60% to 90% ethyl or isopropyl alcohol solution (volume/volume) is optimally bactericidal because the increased ability of water (H2O) to hydrolyze bonds in protein molecules makes the killing of microorganisms more effective. Ethyl or isopropyl alcohol is nonsporicidal (does not kill endospores) and evaporates quickly. Therefore its use is limited to the skin as an antiseptic or on thermometers and injection vial rubber septa as a disinfectant. Stabilized hydrogen peroxide has demonstrated bactericidal, virucidal, sporicidal, and fungicidal activities. Commercially available 3% hydrogen peroxide has been used as a disinfectant on inanimate surfaces. The most common disinfectant in the United States is hypochlorite solutions (NaOCl), 5.25%-6.15%, referred to as household bleach. The disinfecting capability of bleach is bactericidal, virucidal, fungicidal, mycobactericidal, and sporicidal. It is inexpensive and effectiveness is not decreased based on the quality of the water used in the solution preparation. One disadvantage is that hypochlorite may cause minor ocular, oropharyngeal, and esophageal irritation if an individual is exposed to high concentrations without proper ventilation. It is also corrosive to metals in high concentrations, discolors fabrics, and can produce a toxic gas if improperly mixed with ammonia or acid in other cleaning agents. The Centers for Disease Control and Prevention (CDC) recommends that tabletops be cleaned after blood spills with a 1:10 dilution of bleach. Because of their irritating fumes, the aldehydes (formaldehyde and glutaraldehyde) are generally not used as surface disinfectants. Glutaraldehyde, which is sporicidal (kills

CHAPTER 4  Laboratory Safety

endospores) in 3 to 10 hours, is used for medical equipment such as bronchoscopes, because it does not corrode lenses, metal, or rubber. Peracetic acid, effective in the presence of organic material, has also been used for the surface sterilization of surgical instruments. The use of glutaraldehyde or peracetic acid is called cold sterilization. Quaternary ammonium compounds are used to disinfect bench tops or other surfaces in the laboratory. However, gross contamination with organic materials, such as blood, may inactivate heavy metals or quaternary ammonium compounds, thus limiting their utility. They are most often used on noncritical surfaces such as floors, furniture, and walls. Finally, phenolics, such as the common laboratory disinfectant Amphyl (Reckitt Benckiser, Parsippany, NJ), are derivatives of carbolic acid (phenol). The addition of detergent results in a product that cleans and disinfects at the same time, and at concentrations of 2% to 5%, these products are used for cleaning bench tops.

Antiseptics In addition to decontamination of inanimate objects or surfaces, personal laboratory safety and preparation of patients for invasive procedures require the use of an antiseptic. A variety of antiseptics are used to prepare a patient’s skin for blood draws or other invasive procedures. Iodine is prepared either as a tincture with alcohol or as an iodophor coupled to a neutral polymer (e.g., povidone-iodine). Both iodine compounds are widely used antiseptics. In fact, 70% ethyl alcohol, followed by an iodophor, is the most common compound used for skin disinfection before drawing blood specimens for culture or surgery. Because mercury is toxic to the environment, heavy metals containing mercury are no longer recommended. An eye drop solution containing 1% silver nitrate was placed in the eyes of newborns to prevent infections with Neisseria gonorrhoeae. Silver nitrate however, is no longer manufactured in the United States. The current chemical treatment is either an ointment containing erythromycin or povidone iodide. The most important point to remember when working with biocides, antiseptics or disinfectants is to prepare a working solution of the compound exactly according to the manufacturer’s package insert. Many individuals believe that if the manufacturer says to dilute 1:200, they will get a stronger product if they dilute it 1:10. However, the ratio of water to active ingredient may be critical, and if sufficient water is not added, the chemical for surface disinfection may not be effective.

45

with a National Fire Protection Association (NFPA) label stating the health risks, such as carcinogen (cause of cancer), mutagen (cause of mutations in deoxyribonucleic acid [DNA] or ribonucleic acid [RNA]), or teratogen (cause of birth defects), and the hazard class, for example, corrosive (harmful to mucous membranes, skin, eyes, or tissues), poisonous, flammable, or oxidizing (Figure 4-2). Each laboratory should have a chemical hygiene plan that includes guidelines on proper labeling of chemical containers, manufacturers’ material safety data sheets (MSDSs), and the written chemical safety training and retraining programs. Hazardous chemicals must be inventoried annually. In addition, laboratories are required to maintain a file of every chemical they use and a corresponding MSDS. The manufacturer provides the MSDS for every hazardous chemical; some manufacturers also provide letters for nonhazardous chemicals, such as saline, so that these can be included with the other MSDSs. The MSDSs include information on the nature of the chemical, the precautions to take if the chemical is spilled, and disposal recommendations. The sections in the typical MSDS include: • Substance name • Name, address, and telephone number of manufacturer • Hazardous ingredients • Physical and chemical properties • Fire and explosion data • Toxicity • Health effects and first aid • Stability and reactivity • Shipping data • Spill, leak, and disposal procedures • Personal protective equipment • Handling and storage

Chemical Safety In 1987, OSHA published the Hazard Communication Standard, which provides for certain institutional educational practices to ensure that all laboratory personnel have a thorough working knowledge of the hazards of the chemicals with which they work. This standard has also been called the “employee right to know.” It mandates that all hazardous chemicals in the workplace be identified and clearly marked

• Figure 4-2  National Fire Protection Association diamond indicating a chemical hazard. This information can be customized (as shown here for isopropyl alcohol) by applying the appropriate self-adhesive polyester numbers to the corresponding color-coded hazard area. (Courtesy Lab Safety Supply, Janesville, Wisconsin.)

46 PA RT I I  General Principles in Clinical Microbiology

A

B

• Figure 4-3  Fume

hood. A, Model ChemGARD. B, Schematics. Arrows indicate airflow through the cabinet to the outside vent. (Courtesy the Baker Co., Sanford, Maine.)

Employees should become familiar with the location and organization of MSDS files in the laboratory so that they know where to look in the event of an emergency. Fume hoods (Figure 4-3) are provided in the laboratory to prevent inhalation of toxic fumes. Fume hoods protect against chemical odor by exhausting air to the outside, but they are not HEPA-filtered to trap pathogenic microorganisms. It is important to remember that a BSC (discussed later in the chapter) is not a fume hood. Work with toxic or noxious chemicals should always be performed while wearing nitrile gloves, in a fume hood or while wearing a fume mask. Spills should be cleaned up using a fume mask, gloves, impervious (impenetrable to moisture) apron, and goggles. Acid and alkaline, flammable, and radioactive spill kits are available to assist in rendering any chemical spills harmless.

Fire Safety Fire safety is an important component of the laboratory safety program. Each laboratory is required to post fire evacuation plans that are essentially blueprints for finding the nearest exit in case of fire. Fire drills conducted quarterly or annually, depending on local laws, ensure that all personnel know what to do in case of fire. Exit paths should always remain clear of obstructions, and employees should be trained to use fire extinguishers. The local fire department is often an excellent resource for training in the types and use of fire extinguishers. Type A fire extinguishers are used for trash, wood, and paper; type B extinguishers are used for chemical fires; and type C extinguishers are used for electrical fires. Combination type

ABC extinguishers are found in most laboratories so that personnel need not worry about which extinguisher to reach for in case of a fire. However, type C extinguishers, which contain carbon dioxide (CO2) or another dry chemical to smother flames, are also used, because this type of extinguisher does not damage equipment. The important actions in case of fire and the order in which to perform tasks can be remembered with the acronym RACE: 1. Rescue any injured individuals. 2. Activate the fire alarm. 3. Contain (smother) the fire, if feasible (close fire doors). 4. Extinguish the fire, if possible.

Electrical Safety Electrical cords should be checked regularly for fraying and replaced when necessary. All plugs should be the threeprong, grounded type. All sockets should be checked for electrical grounding and leakage at least annually. No extension cords should be used in the laboratory.

Handling of Compressed Gases Compressed gas cylinders (CO2, anaerobic gas mixture) contain pressurized gases and must be properly handled and secured. When leaking cylinders have fallen, tanks have become missiles, resulting in loss of life and destruction of property. Therefore gas tanks should be properly chained (Figure 4-4, A) and stored in well-ventilated areas. The metal cap, which is removed when the regulator is installed, should always be in place when a gas cylinder is not in use.

CHAPTER 4  Laboratory Safety

A

47

B • Figure 4-4  A, Gas cylinders chained to the wall. B, Gas cylinder chained to a dolly during transportation. (Courtesy Lab Safety Supply, Janesville, Wisconsin.)

Cylinders should be transported chained to special dollies (Figure 4-4, B).

Biosafety Individuals are exposed in various ways to health care– associated infections, transporting specimens and in public areas such as elevators or cafeterias, by: • Rubbing the eyes or nose with contaminated hands • Inhaling aerosols produced during centrifugation, mixing with a vortex, or spills of liquid cultures • Accidentally ingesting microorganisms by putting pens or fingers in the mouth • Receiving percutaneous inoculation (i.e., through puncture from an accidental needle stick) • Manipulating or opening bacterial cultures in liquid media or on plates, creating potentially hazardous aerosols, outside of a biosafety hood • Failure to wash hands upon leaving the restroom or other public areas before entering the laboratory Risks from a microbiology laboratory may extend to adjacent laboratories and to the families of those who work in the microbiology laboratory. For example, Blaser and Feldman noted that 5 of 31 individuals who contracted typhoid fever from proficiency testing specimens did not work in a microbiology laboratory. Two patients were family members of a microbiologist who had worked with Salmonella enterica serotype Typhi; two were students whose afternoon class was in the laboratory where the organism had been cultured that morning, and one worked in an adjacent chemistry laboratory.

In the clinical microbiology laboratory, shigellosis, salmonellosis, tuberculosis, brucellosis, and hepatitis are commonly acquired laboratory infections. Additional infections have been reported from agents such as Coxiella burnetii, Francisella tularensis, Trichophyton mentagrophytes, and Coccidioides immitis. Viral agents transmitted through blood and body fluids also cause many health care–associated infections in non–microbiology laboratory workers and in health care workers in general. These include hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), and human immunodeficiency virus (HIV). Laboratory-associated infection is not a new phenomenon, but data are based primarily on voluntary reporting. Therefore such incidents are widely underreported because of fears of repercussions associated with such events.

Exposure Control Plan The laboratory director and supervisor are legally responsible for ensuring that an Exposure Control Plan has been implemented and that the mandated safety guidelines are followed. The plan identifies tasks that are hazardous to employees and promotes employee safety through use of the following: • Employee education and orientation • Appropriate disposal of hazardous waste • Standard (formerly Universal) Precautions • Engineering controls and safe work practices, as well as appropriate waste disposal and use of BSCs • Personal protective equipment (PPE), such as laboratory coats, shoe covers, gowns, gloves, and eye protection (goggles, face shields)

48 PA RT I I  General Principles in Clinical Microbiology

• A postexposure plan for investigating all accidents and a plan to prevent recurrences

Employee Education and Orientation Each institution should have a safety manual that is reviewed by all employees and a safety officer who is knowledgeable about the risks associated with health care–associated infections. The safety officer should provide orientation for new employees and quarterly continuing education updates for all personnel. Initial training and all retraining should be documented in writing. Hand washing should be emphasized for all laboratory personnel. The mechanical action of rubbing the hands together and soaping under the fingernails is the most important part of the process. All employees should also be offered the HBV vaccine and annual tuberculin skin tests for tuberculosis. For employees whose skin tests are already positive or who have previously been vaccinated with bacillus Calmette-Guérin (BCG), the employer should offer chest radiographs upon employment, although follow-up annual chest radiographs are no longer recommended by the CDC.

Disposal of Hazardous Waste All materials contaminated with potentially infectious agents must be decontaminated before disposal. These include unused portions of patient specimens, patient cultures, stock cultures of microorganisms, and disposable sharp instruments, such as glass microscope slides, glass tubes, scalpels, and syringes with needles. It is recommended that syringes with needles not be accepted in the laboratory; staff members should be required to submit capped syringes to the laboratory. Infectious waste may be decontaminated by use of an autoclave, incinerator, or any one of several alternative waste-treatment methods. Some state or local municipalities permit blood, serum, urine, feces, and other body fluids to be carefully poured into a sanitary sewer. Infectious waste from microbiology laboratories is usually autoclaved on site or sent for incineration. In 1986, the EPA published a guide to hazardous waste reduction to limit the amount of hazardous waste generated and released into the environment. These regulations call for the following: • Substituting less hazardous chemicals when possible; for example, substituting ethyl acetate for ether in ova and parasite concentrations, and Hemo-de in place of xylene for trichrome stains • Developing procedures that use less of hazardous chemicals • Segregating infectious waste from uncontaminated (paper) trash • Substituting miniaturized systems for identification and antimicrobial susceptibility testing of potential pathogens to reduce the volume of chemical reagents and infectious waste Recently several alternative waste-treatment machines were developed to reduce the amount of waste buried in

• Figure 4-5  Autoclave

bags. (Courtesy Allegiance Healthcare,

McGaw Park, Illinois.)

landfills. These systems combine mechanical shredding or compacting of the waste with chemical (sodium hypochlorite, chlorine dioxide, peracetic acid), thermal (moist heat, dry heat), or ionizing radiation (microwaves, radio waves) decontamination. Most state regulations for these units require at least a six-fold reduction in vegetative bacteria, fungi, mycobacteria, and enveloped viruses and at least a four-fold reduction in bacterial spores. Infectious waste (agar plates, plastic tubes, and reagent bottles) should be placed into two leak-proof, plastic bags for sturdiness (Figure 4-5); this is known as double bagging. Sharp objects, including pipettes, microscope slides, broken glass, glass tubes or bottles, scalpels, and needles, are placed in sharps containers (Figure 4-6), then autoclaved or incinerated.

Standard Precautions In 1987, the CDC published guidelines known as Universal Precautions to reduce the risk of HBV transmission in clinical laboratories and blood banks. In 1996, these safety recommendations became known as Standard Precautions. These precautions require that blood and body fluids from every patient be treated as potentially infectious. The essentials of Standard Precautions and safe laboratory work practices are as follows: • Do not eat, drink, smoke, or apply cosmetics (including lip balm). • Do not insert or remove contact lenses. • Do not bite nails or chew on pens. • Do not mouth-pipette. • Limit access to the laboratory to trained personnel only. • Assume all patients are infectious for all blood-borne pathogens. • Use appropriate barrier precautions to prevent skin and mucous membrane exposure, including wearing gloves at all times and masks, goggles, gowns, or aprons if splash or droplet formation is a risk.

CHAPTER 4  Laboratory Safety

49

• Figure 4-6  Sharps containers. (Courtesy Lab Safety Supply, Janesville, Wisconsin.)

• Thoroughly wash hands and other skin surfaces after removing gloves and immediately after any contamination. • Take special care to prevent injuries with sharp objects, such as needles and scalpels. Standard Precautions should be followed for handling blood and body fluids, including all secretions and excretions submitted to the microbiology laboratory (e.g., serum, semen, all sterile body fluids, saliva from dental procedures, and vaginal secretions). Standard Precautions applies to blood and all body fluids, except sweat. Practice of Standard Precautions by health care workers handling all patient material lessens the risks associated with such specimens. Among the Standard Precautions, hand washing is one of the single most useful techniques to prevent the transmission and acquisition of infection in a health care setting. Hand washing using running water with plain or antimicrobial soaps do not disrupt the normal microbiota but have demonstrated a reduction in transient microorganisms and viral agents. Studies have indicated that effective hand washing with plain soap versus antimicrobial products are both equally efficient and directly correlates with the duration of the hand washing. All personnel should wash their hands with soap and water after removing gloves, after handling infectious material, and before leaving the laboratory area. When hand washing is not available, waterless alcoholbased (60% to 62%) products provide a rapid and convenient means of controlling transmission of many organisms. However, alcohol-based products are not useful when hands are soiled or contaminated with other organic material such as blood and body fluids. Mouth-pipetting is strictly prohibited. Mechanical devices must be used for drawing all liquids into pipettes. Eating, drinking, and applying cosmetics are strictly forbidden in work areas. Food and drink must be stored in refrigerators in areas separate from the work area. In addition, it is

good practice to store sera collected periodically from all health care workers so that, in the event of an accident, a seroconversion (acquisition of antibodies to an infectious agent) can be documented (see Chapter 9). All health care workers should follow Standard Precautions whether working inside or outside the laboratory. When collecting specimens outside the laboratory, individuals should follow these guidelines: • Wear gloves and a laboratory coat. • Deal carefully with needles and lancets. • Discard sharps in an appropriate, puncture-resistant container. • Never recap needles by hand; if necessary, special safety devices are available. (Needles are available with built-in safety devices to prevent accidental needle sticks).

Engineering Controls Laboratory Environment The biohazard symbol should be prominently displayed on laboratory doors and any equipment (refrigerators, incubators, centrifuges) that contains infectious material. The airhandling system of a microbiology laboratory should move air from lower to higher risk areas, never the reverse. Ideally, the microbiology laboratory should be under negative pressure, and air should not be recirculated after passing through. The selected use of BSCs for procedures that generate infectious aerosols is critical to laboratory safety. Infectious diseases, including the plague, tularemia, brucellosis, tuberculosis, and legionellosis, may be contracted through inhalation of infectious particles present in a droplet of liquid. Because blood is a primary specimen that may contain infectious virus particles, subculturing blood cultures by puncturing the septum with a needle should be performed behind a barrier

50 PA RT I I  General Principles in Clinical Microbiology

to protect the worker from droplets. Several other common procedures used to process specimens for culture, notably mincing, grinding, vortexing, and preparing direct smears for microscopic examination, are known to produce aerosol droplets. These procedures must be performed in a BSC. The microbiology laboratory poses many hazards to unsuspecting and untrained people; therefore, access should be limited to employees and other necessary personnel (biomedical engineers, housekeepers). Visitors, especially young children, should be discouraged. Certain areas of high risk, such as the mycobacteriology and virology laboratories, should be closed to visitors. Custodial personnel should be trained to discriminate among the waste containers, dealing only with those that contain noninfectious material. Care should be taken to prevent insects from infesting any laboratory area. Mites, for example, can crawl over the surface of media, carrying microorganisms from colonies on a plate to other areas. Houseplants can also serve as a source of insects and should be excluded from the laboratory environment. A pest control program should be in place to control rodents and insects.

A

Biologic Safety Cabinet A BSC is a device that encloses a workspace in such a way as to protect workers from aerosol exposure to infectious disease agents. Air that contains the infectious material is sterilized, either by heat, ultraviolet light, or, most commonly, by passage through a HEPA filter that removes most particles larger than 0.3 mm in diameter. These cabinets are designated as class I through III, according to the effective level of biologic containment. Class I cabinets allow room (unsterilized) air to pass into the cabinet and around the area and material within, sterilizing only the air to be exhausted (Figure 4-7). They have negative pressure and may be ventilated to the outside or exhausted to the work area and are usually operated with an open front. Class II cabinets sterilize air that flows over the infectious material, as well as air to be exhausted. The air flows in “sheets,” which serve as barriers to particles from outside the cabinet and direct the flow of contaminated air into the filters (Figure 4-8). Such cabinets are called vertical laminar

B

• Figure 4-7  Class I biologic safety cabinet. A, Model BSC-100. B, Photo showing airflow. (Courtesy the Baker Co., Sanford, Maine.)

Exhaust HEPA filter Supply HEPA filter View screen Access opening, typically 8 inches

Airflow plenum Work area

B A • Figure 4-8  Class

II biologic safety cabinet. A, Model SterilGARD II. B, Schematics showing airflow. (Courtesy the Baker Co., Sanford, Maine.)

CHAPTER 4  Laboratory Safety

flow BSCs. Class II cabinets have a variable sash opening through which the operator gains access to the work surface. Depending on their inlet flow velocity and the percent of air that is HEPA filtered and recirculated, class II cabinets are further differentiated into type A or B. A class IIA cabinet is self-contained, and 70% of the air is recirculated into the work area. The exhaust air in class IIB cabinets is discharged outside the building. A class IIB cabinet is selected if radioisotopes, toxic chemicals, or carcinogens will be used. Because they are completely enclosed and have negative pressure, class III cabinets afford the most protection to the worker. Air coming into and going out of the cabinet is filter sterilized, and the infectious material within is handled with rubber gloves that are attached and sealed to the cabinet (Figure 4-9). Most hospital clinical microbiology laboratory scientists use class IIA or IIB cabinets. Routine inspection and

documentation of adequate function of these cabinets are critical factors in an ongoing quality assurance program. It is important to the proper operation of laminar flow cabinets that an open area of 3 feet around the cabinet be maintained during operation of the air-circulating system; this ensures that infectious material is directed through the HEPA filter. BSCs must be certified initially, whenever moved more than 18 inches, and annually thereafter.

Personal Protective Equipment OSHA regulations require that health care facilities provide employees with all personal protective equipment (PPE) necessary to protect them from hazards encountered during the course of work (Figure 4-10). PPE usually includes plastic shields or goggles to protect workers from droplets, disposal containers for sharp objects, holders for glass

Total exhaust

Exhaust collar with air-tight damper

Exhaust filter Air intake Supply filter Airflow plenum Work area access

Fixed view screen Negative pressure system Glove ports

Work area

A

B • Figure 4-9  Class III biologic safety cabinet. A, Custom-built class III system. B, Schematics with arrows showing airflow through cabinet. (Courtesy the Baker Co., Sanford, Maine.)

A • Figure 4-10  Personal

51

B

protective equipment. A, A microbiologist wearing a laboratory gown, gloves, goggles, and face mask. B, A microbiologist wearing a laboratory coat, gloves, and hood with a shield attached to a HEPA filter pack with a high efficiency particulate air system.

52 PA RT I I  General Principles in Clinical Microbiology

bottles, trays in which to carry smaller hazardous items (e.g., blood culture bottles), handheld pipetting devices, impervious gowns, laboratory coats, disposable gloves, masks, safety carriers for centrifuges (especially those used in the acid fast bacteriology [AFB] laboratory), and HEPA respirators. HEPA respirators are required for all health care workers, including phlebotomists, who enter the rooms of patients with tuberculosis, as well as workers who clean up spills of pathogenic microorganisms (see Chapter 78). All respirators should be fit-tested for each individual so that each person is assured that his or hers is working properly. Men must shave their facial hair to achieve a tight fit. Respirators are evaluated according to guidelines of the National Institute for Occupational Safety and Health (NIOSH), a branch of the CDC. N95 or P100 disposable masks are commonly used in the clinical laboratory and are available from a variety of manufacturers. Microbiologists should wear laboratory coats over their street clothes, and these coats should be removed before leaving the laboratory. Most exposures to blood-containing fluids occur on the hands or forearms, so gowns with closed wrists or forearm covers and gloves that cover all potentially exposed skin on the arms are most beneficial. If the laboratory protective clothing becomes contaminated with body fluids or potential pathogens, it should be sterilized in an autoclave immediately and cleaned before reusing. The institution or a uniform agency should clean laboratory coats; it is no longer permissible for microbiologists to launder their own coats. Alternatively, disposable gowns may be used. A variety of cost-effective disposable laboratory gowns are available commercially. Obviously, laboratory workers who plan to enter an area of the hospital where patients at special risk of acquiring infection are present (e.g., intensive care units, the nursery, operating rooms, or areas in which immunosuppressive therapy is being administered) should take every precaution to cover their street clothes with clean or sterile protective clothing appropriate to the area. Special impervious protective clothing is advisable for certain activities, such as working with radioactive substances or caustic chemicals. Solid-front gowns are indicated for those working with specimens being cultured for mycobacteria. Unless large-volume spills of potentially infectious material are anticipated, impervious laboratory gowns are not necessary in most microbiology laboratories.

Postexposure Control All laboratory accidents and potential exposures must be reported to the supervisor and safety officer, who will immediately arrange to send the individual to employee health or an outside occupational health physician. Immediate medical care is of foremost importance; investigation of the accident should take place after the employee has received appropriate care. If the accident is a needle stick injury, for example, the patient should be identified and the risk of the laboratorian acquiring a blood-borne infection should

be assessed. The investigation helps the physician determine the need for prophylaxis, such as hepatitis B virus immunoglobulin (HBIG) or an HBV booster immunization in the event of exposure to hepatitis B. The physician also is able to discuss the potential for disease transmission to family members, such as after exposure to a patient with Neisseria meningitidis. Postexposure prophylaxis should be administered, and additional sera should be collected at intervals of 6 weeks, 3 months, and 6 months for HIV testing. Finally, the safety committee, or at least the laboratory director and safety officer, should review the events of the accident to determine whether it could have been prevented and to delineate measures to prevent future accidents. The investigation of the accident and corrective action should be documented in an incident report.

Classification of Biologic Agents Based on Hazard The Classification of Etiological Agents on the Basis of Hazard, published by the CDC, served as a reference for assessing the relative risks of working with various biologic agents until the CDC, together with the National Institutes of Health (NIH), produced the manual Biosafety in Microbiological and Biomedical Laboratories. The manual is available on the CDC website (www.cdc.gov/biosafety/publications/ bmbl5/BMBL.pdf ). In general, patient specimens pose a greater risk to laboratory workers than do microorganisms in culture, because the nature of etiologic agents in patient specimens is initially unknown. Biosafety Level 1 (BSL-1) agents include those that have no known potential for infecting healthy people and are well defined and characterized. These agents are used in laboratory teaching exercises for undergraduate students, secondary educational training, and teaching laboratories for students in microbiology. BSL-1 agents include Bacillus subtilis and Naegleria gruberi; in addition, exempt organisms under the NIH guidelines are representative microorganisms in this category. Precautions for working with BSL-1 agents include standard good laboratory technique, as described previously. BSL-2 agents are those most commonly being sought in clinical specimens and used in diagnostic, teaching, and other laboratories. They include all the common agents of infectious disease, as well as HIV, hepatitis B virus, Salmonella organisms, and several more unusual pathogens. For the handling of clinical specimens suspected of harboring any of these pathogens, BSL-2 precautions are sufficient. Specimens expected to contain prions (PrPSc), abnormal proteins associated with neurodegenerative diseases, including spongiform encephalitis, should be handled using BSL-2 procedures. This level of safety includes the principles outlined previously, provided the potential for splash or aerosol is low. If splash or aerosol is probable, the use of primary containment equipment is recommended, as

CHAPTER 4  Laboratory Safety

are limiting access to the laboratory during working procedures, training laboratory personnel in handling pathogenic agents, direction by competent supervisors, and performing aerosol-generating procedures in a BSC. Employers must offer hepatitis B vaccine to all employees determined to be at risk of exposure. BSL-3 procedures have been recommended for the handling of material suspected of harboring organisms unlikely to be encountered in a routine clinical laboratory and for such organisms as Mycobacterium tuberculosis, Coxiella burnetii, and the mold stages of systemic fungi and for some other organisms when grown in quantities greater than that found in patient specimens. These precautions, in addition to those undertaken for BSL-2 agents, consist of laboratory design and engineering controls that contain potentially dangerous material by careful control of air movement and the requirement that personnel wear protective clothing and gloves, for instance. Those working with BSL-3 agents should have baseline sera specimens stored for comparison with acute sera that can be drawn in the event of unexplained illness. BSL-3 organisms are primarily transmitted by infectious aerosol. BSL-4 agents are exotic agents that are considered high risk and cause life-threatening disease. They include Marburg virus or Congo-Crimean hemorrhagic fever. Personnel and all materials must be decontaminated before leaving the facility, and all procedures are performed under maximum containment (special protective clothing, class III BSC). Most of the facilities that deal with BSL-4 agents are public health or research laboratories. As mentioned, BSL-4 agents pose life-threatening risks and are transmitted via aerosols; in addition, no vaccine or therapy is available for these organisms.

Mailing Biohazardous Materials In March 2005, the requirements for packaging and shipping biologic materials were significantly revised in response to an international desire to ensure reasonable yet safe and trouble-free shipment practices for infectious material. Before this date, clinical specimens submitted for infectious disease diagnosis, as well as isolates of any microorganism, were considered an “infectious substance” and packaged and labeled under UN 6.2 dangerous goods regulations. Infectious substances now are classified as category A, B, or C organisms. A category A specimen is an infectious substance capable of causing disease in healthy humans and animals; it is assigned to division UN 6.2, UN 2814, UN 2900, or UN 3373. Category B includes infectious substances that are not included in category A and are assigned to UN 3373. Only the category A organisms or specimens listed in Table 4-1 must be shipped as dangerous goods. The UN created the designation UN 3373 so that non–category A specimens or cultures can be packed and shipped as diagnostic or clinical specimens. The proper shipping name for a UN 3371 specimen is “biological substance, category B.”

53

The use of the former shipping names for diagnostic or clinical specimens is no longer permitted. If the laboratory director is unsure whether a patient has symptoms of a category A agent, it is prudent to ship the specimen as an infectious substance rather than a biologic substance. Figure 4-11, A, shows triple packaging for diagnostic, clinical, or infectious substances in a pouch; Figure 4-11, B, shows triple packaging for diagnostic, clinical, or infectious substances in a rigid bottle. Packaging must meet the requirements of the International Air Transport Association (IATA) and the International Civil Aviation Organization (IACO). Packaging instructions are available in the annual IATA regulations under section 620 (dangerous goods). All air and ground shippers, such as the U.S. Postal Service (USPS), the U.S. Department of Transportation (DOT), and Federal Express (Fed Ex), have adopted IATA standards. Training in the proper packing and shipping of infectious material is a key feature of the regulations. Every institution that ships infectious materials, whether a hospital or physician office laboratory (POL), is required to have appropriately trained individuals; training may be obtained through carriers, package manufacturers, and special safety training organizations. The shipper is the individual (institution) ultimately responsible for safe and appropriate packaging. Any fines or penalties are the shipper’s responsibility. Infectious specimens or isolates should be wrapped with absorbent material and placed inside a plastic biohazard bag, called a primary receptacle. The primary receptacle is then inserted into a secondary container, most often a watertight, hard plastic mailer. The secondary container is capped and placed inside an outer, tertiary container that protects it from physical and water damage (Figure 4-11, B). A UN class 6 label on the outer box confirms that the packaging meets all the required standards. The package must display the UN Packaging Specification Marking and must be labeled with a specific hazard label as an infectious substance. A packing list and a Shippers Declaration for Dangerous Goods Form must accompany the air bill or ground form. Diagnostic or clinical specimens are packaged similarly, but a UN specification marking is not required and it is not necessary to fill out a shipper declaration. The shipper should note that some carriers have additional requirements for coolant materials, such as ice, dry ice, or liquid nitrogen. Because the shipper is liable for appropriate packaging, it is best to check with individual carriers in special circumstances and update the instructions yearly when the new IATA Dangerous Goods Regulations are published. IATA regulations can be found at the website www.iata.org. International importation or exportation of biologic agents requires a permit from the CDC. Information on importing and exporting a variety of materials may be found at http://www.cdc.gov/laboratory/specimensubmission/shipping-packing.html.

  Visit the Evolve site for a complete list of procedures, review questions, and case study answers.

TABLE Examples of Infectious Substances Included in Category A 4-1

UN Number and Proper Shipping Name

Microorganisms

UN 2814—Infectious Substance Affecting Humans

Bacillus anthracis (cultures only)* Brucella abortus (cultures only)* Brucella melitensis (cultures only)* Brucella suis (cultures only)* Burkholderia mallei—Pseudomonas mallei-Glanders (cultures only)* Burkholderia pseudomallei—Pseudomonas pseudomallei (cultures only)* Chlamydia psittaci—avian strains (cultures only) Clostridium botulinum (cultures only) Coccidioides immitis (cultures only) Coxiella burnetii (cultures only) Crimean-Congo hemorrhagic fever virus* Dengue virus (cultures only) Eastern equine encephalitis virus (cultures only)* Escherichia coli, verotoxigenic (cultures only) Ebola virus* Flexal virus Francisella tularensis (cultures only)* Guanarito virus Hantaan virus Hantaviruses causing hantavirus pulmonary syndrome Hendra virus* Hepatitis B virus (cultures only) Herpes B virus (cultures only) Human immunodeficiency virus (cultures only) Highly pathogenic avian influenza virus (cultures only) Japanese encephalitis virus (cultures only) Junin virus Kyasanur Forest disease virus Lassa virus* Machupo virus Marburg virus* Monkeypox virus* Mycobacterium tuberculosis (cultures only) Nipah virus* Omsk hemorrhagic fever virus Poliovirus (cultures only) Rabies virus (cultures only) Rickettsia prowazekii (cultures only)* Rickettsia rickettsii (cultures only)* Rift Valley fever virus* Russian spring-summer encephalitis virus (cultures only) Sabia virus Shigella dysenteriae type 1 (cultures only) Tick-borne encephalitis virus (cultures only) Variola virus Venezuelan equine encephalitis virus (cultures only)* West Nile virus (cultures only) Yellow fever virus (cultures only) Yersinia pestis (cultures only)

UN 2900—Infectious Substance Affecting Animals

African swine fever virus (cultures only)* Avian paramyxovirus type 1—Velogenic Newcastle disease virus (cultures only) Classical swine fever virus (cultures only) Foot and mouth disease virus (cultures only) Lumpy skin disease virus (cultures only) Mycoplasma mycoides—Contagious bovine pleuropneumonia (cultures only)* Peste des petits ruminants virus (cultures only)* Rinderpest virus (cultures only)* Sheep-pox virus (cultures only)* Goatpox virus (cultures only) Swine vesicular disease virus (cultures only)* Vesicular stomatitis virus (cultures only)*

This table is not exhaustive. Infectious substances, including new or emerging pathogens, that do not appear in the table but that meet the same criteria must be assigned to category A. In addition, if doubt exists as to whether a substance meets the criteria, it must be included in category A. *An infectious agent also designated as a “select agent” that has the potential to pose a severe threat to public health and safety.

CHAPTER 4  Laboratory Safety

A

55

B • Figure 4-11  A, The Bio-Pouch (lower right) is made of laminated, low-density polyethylene, which is

virtually unbreakable. The label for shipping a diagnostic specimen is shown (UN 3373). B, The Bio-Bottle is made of high-density polyethylene and is used as the secondary container. This packaging is used for both types of infectious substances (the class 6 label is shown) with the UN 3373 label. (Courtesy Air Sea Containers, Miami, Florida.)

Bibliography Bennett J, Dolin R, Blaser M: Principles and practice of infectious diseases, ed 8, Philadelphia, Pa, 2015, Elsevier Saunders. Blaser MJ, Feldman RA: Acquisition of typhoid fever from proficiency testing specimens, N Engl J Med 303:1481, 1980. Centers for Disease Control: Update: universal precautions for prevention of transmission of human immunodeficiency virus, hepatitis B virus, and other blood-borne pathogens in health care settings, MMWR Morb Mortal Wkly Rep 37:377, 1988. Centers for Disease Control: Recommendations for prevention of HIV transmission in health-care settings, MMWR Morb Mortal Wkly Rep 36:3S, 1987. Fleming DO, Hunt DL: Biological safety: principles and practices, ed 3, Washington, DC, 2000, ASM Press. Hospital Infection Control Practices Advisory Committee: Guideline for isolation precautions in hospitals, Infect Control Hosp Epidemiol 17:53, 1996. International Air Transport Association: Dangerous goods regulations, ed 46, Montreal, 2005, International Air Transport Association.

Jorgensen J, Pfaller M, Carroll K, et al: Manual of clinical microbiology, ed 11, Washington, DC, 2015, ASM Press. Occupational Safety and Health Administration: Occupational exposure to blood-borne pathogens: final rule, Fed Regist 56:64175, 1991. Occupational Safety and Health Administration: Occupational exposure to blood-borne pathogens: correction July 1, 1992, 29 CFR Part 1910, Fed Regist 57:127, 29206, 1991. Occupational Safety and Health Administration: Draft guidelines for preventing the transmission of tuberculosis in health care facilities, Fed Regist 58:52810, 1993. Sewell DL: Laboratory-associated infections and biosafety, Clin Microbiol Rev 8:389, 1995. United States Department of Health and Human Services: Biosafety in microbiological and biomedical laboratories, ed 5, Washington, DC, 2009, US Government Printing Office. United States Environmental Protection Agency: EPA guide for infectious waste management, Publication EPA/530-SW-86-014, Washington, DC, 1986, US Environmental Protection Agency.

5

Specimen Management OBJECTIVES 1. State four critical parameters that should be monitored in the laboratory from specimen collection to set up and describe the effects each may have on the quality of the laboratory results (e.g., false negatives or positives, inadequate specimen type, incorrect sample). 2. Identify the proper or improper labeling of a specimen, and determine the adequacy of a specimen given a patient scenario. 3. Define and differentiate backup broth, nutritive media, and differential and selective media. 4. Describe the oxygenation states (atmospheric conditions) associated with anaerobic, facultative anaerobic, capnophilic, aerobic, and microaerophilic organisms. Provide an example for each. 5. Determine specimen acceptability and the proper procedure for rejection or recollection. 6. List the critical parameters associated with the reporting of direct and indirect organism detection.

I

n the late 1800s, the first clinical microbiology laboratories were organized to diagnose infectious diseases such as tuberculosis, typhoid fever, malaria, intestinal parasites, syphilis, gonorrhea, and diphtheria. Between 1860 and 1900, microbiologists such as Pasteur, Koch, and Gram developed the techniques for staining and the use of solid media for isolation of microorganisms that are still used in clinical laboratories today. Microbiologists continue to look for the same organisms that these laboratorians did, as well as a whole range of others that have been discovered, for example, Legionella, viral infections, nontuberculosis acid-fast bacteria, and fungal infections. Microbiologists work in public health laboratories, hospital laboratories, reference or independent laboratories, and physician office laboratories (POLs). The current trend in the diagnostic setting is changing the landscape of laboratory services. Many health care systems are consolidating microbiology to a single laboratory. This creates a potential for an increase in the time between specimen collection and processing. The result may be a delay in reporting critical results and compromised integrity of the specimen. 56

Depending on the level of service and type of testing at each facility, in general a microbiologist will perform one or more of the following functions: • Cultivation (growth), identification, and antimicrobial susceptibility testing of microorganisms • Direct detection of infecting organisms by microscopy • Direct detection of specific products of infecting organisms using chemical, immunologic, or molecular techniques • Detection of antibodies produced by the patient in response to an infecting organism (serology) This chapter presents an overview of issues involved in infectious disease diagnostic testing. Many of these issues are covered in detail in separate chapters.

General Concepts for Specimen Collection and Handling Specimen collection and transportation are critical considerations, because results generated by the laboratory are limited by the quality and condition of the specimen upon arrival in the laboratory. Specimens should be obtained to preclude or minimize the possibility of introducing contaminating microorganisms that are not involved in the infectious process and can either interfere with the growth of or outgrow the pathogen. This is a particular problem, for example, in specimens collected from mucous membranes that are already colonized with an individual’s endogenous or “normal” microbiota; these organisms are usually contaminants but may also be opportunistic pathogens. For example, the throats of hospitalized patients on ventilators may be colonized with Klebsiella pneumoniae; although K. pneumoniae is not usually involved in cases of community-acquired pneumonia, it can cause a hospital-acquired respiratory infection in this subset of patients. Using special techniques that bypass areas containing normal microbiota when feasible (e.g., covered-brush bronchoscopy in critically ill patients with pneumonia) prevents many problems associated with false-positive results. Likewise, careful skin preparation before procedures such as blood cultures and spinal taps decreases the chance that organisms normally present on the skin will contaminate the specimen.

CHAPTER 5  Specimen Management

Appropriate Collection Techniques Specimens should be collected during the acute (early) phase of an illness (or within 2 to 3 days for viral infections) and before antimicrobials, antifungals, or antiviral medications are administered, if possible. Swabs generally are poor specimens if tissue or needle aspirates can be obtained. It is the microbiologist’s responsibility to provide clinicians with a collection manual or instruction cards listing optimal specimen collection techniques and transport information. Information for the nursing staff and clinicians should include the following: • Safety considerations • Selection of the appropriate anatomic site and specimen • Collection instructions, including the type of swab or transport medium • Transportation instructions, including time and temperature constraints • Labeling instructions, including patient demographic information (minimum of two patient identifiers) • Special instructions, such as patient preparation • Sterile versus nonsterile collection devices • Minimal acceptable quality and recommended quantity Instructions should be written so that specimens collected by the patient (e.g., urine, sputum, or stool) are handled properly. Most urine or stool collection kits contain instructions in several languages, but nothing substitutes for a concise set of verbal instructions. Similarly, when distributing kits for sputum collection, the microbiologist should be able to explain to the patient the difference between spitting in a cup (saliva) and producing good lower respiratory secretions from a deep cough (sputum). General collection information is shown in Table 5-1. An in-depth discussion of each type of specimen is found in Part VII.

Specimen Transport Ideally, specimens should be transported to the laboratory within 2 hours of collection. All specimen containers should be leak-proof, and the specimens should be transported within sealable, leak-proof, plastic bags with a separate section for paperwork; resealable bags or bags with a permanent seal are common for this purpose. Bags should be marked with a biohazard label (Figure 5-1). Many microorganisms are susceptible to environmental conditions such as the presence of oxygen (anaerobic bacteria), changes in temperature (Neisseria meningitidis), or changes in pH (Shigella). Thus the use of special preservatives or temperaturecontrolled or holding media for the transportation of specimens delayed for more than 2 hours is important to ensure organism viability (survival).

Specimen Preservation Preservatives, such as boric acid for urine or polyvinyl alcohol (PVA) and buffered formalin for stool for ova and

57

parasite (O&P) examination, are designed to maintain the appropriate colony counts (for urines) or the integrity of trophozoites and cysts (for O&Ps), respectively. Other transport or holding media maintain the viability of microorganisms present in a specimen without supporting the growth of the organisms. This maintains the organisms in a state of suspended animation so that no organism overgrows another or dies out. Stuart’s medium and Amie’s medium are two common holding media. Sometimes charcoal is added to these media to absorb fatty acids present in the specimen that could result in pH changes in the media and the killing of fastidious (fragile) organisms such as Neisseria gonorrhoeae or Bordetella pertussis. Anticoagulants are used to prevent clotting of specimens such as blood, bone marrow, and synovial fluid, because microorganisms will otherwise be bound up in the clot. The type and concentration of anticoagulant is very important, because many organisms are inhibited by some of these chemicals. Sodium polyanethol sulfonate (SPS) at a concentration of 0.025% (w/v) is usually used, because Neisseria spp. and some anaerobic bacteria are particularly sensitive to higher concentrations. Because the ratio of specimen to SPS is so important, it is necessary to have both large (adult-size) and small (pediatric-size) tubes available, so organisms in small amounts of bone marrow or synovial fluid are not overwhelmed by the concentration of SPS. SPS is also included in blood culture collection systems. Heparin is also a commonly used anticoagulant, especially for viral cultures, although it may inhibit growth of gram-positive bacteria and yeast. Citrate, ethylenediaminetetraacetic acid (EDTA), or other anticoagulants should not be used for microbiology, because their efficacy has not been demonstrated for most organisms. It is the microbiologist’s job to make sure media containing the appropriate anticoagulant is used for each procedure. The laboratory generally should not specify a color (“yellow-top”) tube for collection without specifying the anticoagulant (SPS), because at least one popular brand of collection tube (Vacutainer, Becton, Dickinson and Company) has a yellow-top tube with either SPS or trisodium citrate/citric acid/dextrose (ACD); ACD is not appropriate for use in microbiology.

Specimen Storage If specimens cannot be processed as soon as they are received, they must be stored (Table 5-1). Several storage methods are used (refrigerator temperature [4°C], ambient [room] temperature [22°C], body temperature [37°C], and freezer temperature [either 220° or 270°C]), depending on the type of transport media (if applicable) and the etiologic (infectious) agents suspected. Urine, stool, viral specimens, sputa, swabs, and foreign devices such as catheters should be stored at 4°C. Serum for serologic studies may be frozen for up to 1 week at 220°C, and tissues or specimens for longterm storage should be frozen at 270°C. Text continued on page 66

Specimen

Container

Patient Preparation

Special Instructions

Transportation to Laboratory

Storage Before Processing

Primary Plating Media

Direct Examination

Comments

Abscess (also Lesion, Wound, Pustule, Ulcer) Superficial

Aerobic swab moistened with Stuart’s or Amie’s medium

Wipe area with sterile saline or 70% alcohol.

Aspirate if possible, swab along leading edge of wound.

,2 hrs

24 hrs/RT

BA, CA, Mac, CNA optional

Gram

Add CNA if smear suggests mixed gram-positive and gramnegative flora

Deep

Anaerobic transporter

Wipe area with sterile saline or 70% alcohol.

Aspirate material from wall or excise tissue.

,2 hrs

24 hrs/RT

BA, CA, Mac, CNA anaerobic BBA, LKV, BBE

Gram

Wash any granules and “emulsify” in saline

Blood or Bone Marrow Aspirate Blood culture media set (aerobic and anaerobic bottle) or Vacutainer tube with SPS

Disinfect venipuncture site with 70% alcohol.

Draw blood at time of febrile episode; draw two sets from right and left arms; do not draw more than three sets in a 24-hr period; draw 20 mL/set (adults) or 1-20 mL/set (pediatric) depending on patient’s weight; or per manufacturer’s instructions.

Within 2 hrs/RT

,2 hrs/RT Must be incubated at 37°C on receipt in laboratory.

Blood culture bottles may be used; BA, CA BBAanaerobic

Direct Gram stain from positive blood culture bottles

Other considerations: brucellosis, tularemia, cell wall– deficient bacteria, leptospirosis, or AFB; blood cultures should be collected before administration of antibiotics when possible

Sterile, screwcap tube or anaerobic transporter or direct inoculation into blood culture bottles

Disinfect skin with iodine preparation before aspirating specimen.

Needle aspiration

,15 min

,24 hrs/RT Plate as soon as received. Incubate blood culture bottles at 37°C on receipt in laboratory. ,24 hrs/4°C: Pericardial fluid and fluids for fungal cultures

May use an aerobic and anaerobic blood culture bottle set for body fluids; BA, CA, thio, CNA, Mac (peritoneal) BBA, BBE, LKV anaerobic

Gram (vaginal fluid is recommended)

May need to concentrate by centrifugation or filtration—stain and culture sediment

Body Fluids Amniotic, abdominal, ascites (peritoneal), bile, joint (synovial), pericardial, pleural

58 PA RT I I  General Principles in Clinical Microbiology

TABLE Collection, Transport, Storage, and Processing of Specimens Commonly Submitted to a Microbiology Laboratory* 5-1

Sterile, screw-cap container

Aerobic swab moistened with Stuart’s or Amie’s medium

Outer

Aerobic swab moistened with Stuart’s or Amie’s medium

Sterile, screw-cap tube

Conjunctiva

Aqueous/ vitreous fluid

Eye

Sterile, screwcap tube or anaerobic transporter

Inner

Ear

Sterile, screwcap tube

Cerebrospinal Fluid (CSF)

Bone

Prepare eye for needle aspiration.

Wipe away crust with sterile saline.

Clean ear canal with mild soap solution.

Disinfect skin with iodine or chlorhexidine before aspirating specimen.

Disinfect skin before surgical procedure.

Sample both eyes; use separate swabs premoistened with sterile saline.

Firmly rotate swab in outer canal.

Aspirate material behind drum with syringe if ear drum intact; use flexible shaft swab to collect material from ruptured ear drum.

Consider rapid testing (e.g., Gram stain; cryptococcal antigen).

Take sample from affected area for biopsy.

,15 min/RT

,2 hrs/RT

,2 hrs/RT

,2 hrs

,15 min

Immediately/RT

,24 hrs/RT Set up immediately on receipt.

24 hrs/RT

24 hrs/4° C

24 hrs/RT

,24 hrs Routine incubate at 37°C, except for viruses, which can be held at 4°C for up to 3 days.

Plate as soon as received.

BA, Mac, 7H10, Ana

BA, CA, Mac

BA, CA, Mac

BA, CA, Mac (add thio if prior antimicrobial therapy) BBA (anaerobic)

BA, CA (Routine) BA, CA, thio (shunt)

BA, CA, Mac, thio

Gram/AO

Gram, AO, histologic stains (e.g., Giemsa)

Gram

Gram

Gram—best sensitivity by cytocentrifugation (may also want to do AO if cytocentrifuge not available)

Gram

Continued

Other considerations: fungal media; some anesthetics may be inhibitory to some organisms

Other considerations: Chlamydia trachomatis, viruses, and fungi

Add anaerobic culture plates for tympanocentesis specimens.

Add thio for CSF collected from shunt Recommended to also collect blood culture

May need to homogenize

CHAPTER 5  Specimen Management

59

Patient Preparation

Special Instructions

Transportation to Laboratory

Storage Before Processing

Primary Plating Media

Direct Examination

,24 hrs/RT Must be incubated at 28°C (SDA) or 37°C (everything else) on receipt in laboratory.

BHI 10% Sheep blood, CA, SDA with antibiotics

Gram/AO The use of 10-mm frosted ring slides assists with location of specimen because of the size of the specimen

Other considerations: Acanthamoeba spp., herpes simplex virus and other viruses, Chlamydia trachomatis, and fungi

,15 min/RT

Plate as soon as received.

Thio

Do not culture Foley catheters; IV catheters are cultured quantitatively by rolling the segment back and forth across agar with sterile forceps four times; 15 colonies are associated with clinical significance.

,15 min/RT

Plate as soon as received, if possible; store ,2 hrs/4°C

BA, Thio, prosthetic valves

Most gastric aspirates are on infants or for AFB.

,15 min/RT

,24 hrs/4°C Must be neutralized with sodium bicarbonate within 1 hr of collection

BA, CA, Mac, HE, CNA, EB

Gram/AO

Other considerations: AFB

Rapid urease test or culture for Helicobacter pylori.

,1 hr/RT

24 hrs/4°C

Skirrow, BA, BBA

H&E stain optional: immunostaining

Other considerations: urea breath test; antigen test (H. pylori)

Specimen

Container

Corneal scrapings

Bedside inoculation of BHI 10%

Clinician should instill local anesthetic before collection.

,15 min/RT

IUD

Sterile, screw-cap container

Disinfect skin before removal.

IV catheters, pins

Sterile, screw-cap container

Disinfect skin with alcohol before removal.

Gastric aspirate

Sterile, screwcap tube

Collect in early AM before patient eats or gets out of bed.

Gastric biopsy

Sterile, screwcap tube (normal saline ,2 hrs transport medium recommended)

Comments

Foreign Bodies

GI Tract

60 PA RT I I  General Principles in Clinical Microbiology

TABLE Collection, Transport, Storage, and Processing of Specimens Commonly Submitted to a Microbiology Laboratory—cont'd 5-1

Swab placed in enteric transport medium

Clean, leakproof container; transfer feces to enteric transport medium (Cary-Blair) if transport will exceed 1 hr

O&P transporters (e.g., 10% formalin and PVA)

Rectal swab

Stool (feces) routine culture

O&P

Collect three specimens every other day at a minimum for outpatients; hospitalized patients (inpatients) should have a daily specimen collected for 3 days; specimens from inpatients hospitalized more than 3 days should be discouraged.

Wait 5-10 days minimum (up to 2 weeks) if patient has received antiparasitic compounds, barium, iron, Kaopectate, metronidazole, Milk of Magnesia, Pepto-Bismol, or tetracycline.

Routine culture should include Salmonella, Shigella, and Campylobacter; specify Vibrio, Aeromonas, Plesiomonas, Yersinia, Escherichia coli O157:H7, if needed. Follow-up may include Shiga toxin assay as recommended by CDC.

Insert swab , 1-1.5 cm past anal sphincter; feces should be visible on swab.

Fresh nonpreserved liquid specimens should be examined within 30 minutes of passage; semiformed within 1 hour of passage. Specimen in fixatives, 24 hrs/RT

Within 24 hrs/ RT in holding media Unpreserved ,1 hr/RT

,2 hrs/RT

Indefinitely/RT

24 hrs/4°C ,48 hrs/RT or 4°C

,24 hrs/RT

BA, Mac, XLD, HE, Campy, EB; optional: Mac-S; chromogenic agar

BA, Mac, XLD HE, Campy, EB

Liquid specimen should be examined for the presence of motile organisms

Methylene blue for fecal leukocytes; optional: Shiga toxin testing

Methylene blue for fecal leukocytes

Continued

See considerations in previous rectal swabs Do not perform routine stool cultures for patients whose length of stay in the hospital exceeds 3 days and whose admitting diagnosis was not diarrhea; these patients should be tested for Clostridium difficile

Other considerations: Vibrio, Yersinia enterocolitica, Escherichia coli O157:H7, N. gonorrhoeae, Shigella, Campylobacter, herpes simplex virus and carriage of group B streptococci

CHAPTER 5  Specimen Management

61

Anaerobic transporter

Swab moistened with Stuart’s or Amie’s medium

Anaerobic transporter

Anaerobic transporter

Swab moistened with Stuart’s or Amie’s medium

Cervix

Cul-de-sac

Endometrium

Urethra

Container

Bartholin cyst

Genital Tract Female

Specimen

Collect 1 hour after patient’s last urination. Remove exudate from urethral opening.

Remove mucus before collection of specimen.

Disinfect skin with iodine preparation before collection.

Patient Preparation

Collect discharge by massaging urethra against pubic symphysis or insert flexible swab 2-4 cm into urethra and rotate swab for 2 seconds; collect at least 1 hr after patient has urinated.

Surgical biopsy or transcervical aspirate via sheathed catheter

Submit aspirate.

Do not use lubricant on speculum; use viral/chlamydial transport medium, if necessary; swab deeply into endocervical canal.

Aspirate fluid; consider chlamydia and GC culture.

Special Instructions

,2 hrs/RT

,2 hrs/RT

,2 hrs/RT

,2 hrs/RT

,2 hrs/RT

Transportation to Laboratory

24 hrs/RT

24 hrs/RT

24 hrs/RT

24 hrs/RT

24 hrs/RT

Storage Before Processing

BA, CA, TM

BA, CA, Mac, TM, Ana

BA, CA, Mac, TM, Ana

BA, CA, Mac, TM

BA, CA, Mac, TM, Ana

Primary Plating Media

Gram

Gram

Gram

Gram

Gram

Direct Examination

TABLE Collection, Transport, Storage, and Processing of Specimens Commonly Submitted to a Microbiology Laboratory—cont'd 5-1

Other considerations: chlamydia, mycoplasma

Comments

62 PA RT I I  General Principles in Clinical Microbiology

Con

ntinued

Vagina

Swab moistened with Stuart’s or Amie’s medium or JEMBEC transport system

Remove exudate.

Swab secretions and mucous membrane of vagina. If a smear is also required, use a second swab.

,2 hrs/RT

24 hrs/RT

BA, TM Culture is not recommended for the diagnosis of bacterial vaginosis; inoculate selective medium for group B streptococcus (LIM broth) if indicated for pregnant women

Gram

Prostate

Swab moistened with Stuart’s or Amie’s medium or sterile, screw-cap tube

Clean urethral meatus with soap and water and massage the prostrate through the rectum.

Collect secretions on swab or in tube.

,2 hrs/RT for swab; immediately if in tube/RT

24 hrs/RT for swab; plate secretions immediately if in tube

BA, CA, Mac, TM, CNA

Gram

Urethra

Swab moistened with Stuart’s or Amie’s medium or JEMBEC transport system

Insert flexible swab 2-4 cm into urethra and rotate for 2 seconds or collect discharge on JEMBEC transport system.

,2 hrs/RT for swab; within 2 hrs for JEMBEC system

24 hrs/RT for swab; put JEMBEC at 37°C immediately on receipt in laboratory

BA, CA, TM

Gram

Hair: collect hairs with intact shaft Nails: send clippings of affected area Skin: scrape skin at leading edge of lesion

Within 72 hrs/RT

Indefinitely/RT

SDA, IMAcg, SDAcg

CW

Examine Gram stain for bacterial vaginosis, especially white blood cells, clue cells, grampositive rods indicative of Lactobacillus, and curved, gram-negative rods indicative of Mobiluncus spp.

Male

Other considerations: chlamydia, mycoplasma

Clean, screw-top tube

Nails or skin: wipe with 70% alcohol

Continued

CHAPTER 5  Specimen Management

Hair, Nails, or Skin Scrapings (for fungal culture)

63

Container

Sterile, screw-top container

Sputum, tracheal aspirate (suction)

Swab moistened with Stuart’s or Amie’s medium

Swab moistened with Stuart’s or Amie’s medium

Nasopharynx Nose

Pharynx (throat)

Upper

Sterile, screw-top container

BAL, BB, BW

Respiratory Tract Lower

Specimen

Have patient brush teeth and then rinse or gargle with water before collection.

Patient Preparation

Swab posterior pharynx and tonsils; routine culture for group A streptococcus (S. pyogenes) only.

Insert flexible swab through nose into posterior nasopharynx and rotate for 5 seconds; specimen of choice for Bordetella pertussis.

Have patient collect from deep cough; specimen should be examined for suitability for culture by Gram stain; induced sputa on pediatric or uncooperative patients may be watery because of saline nebulization.

Anaerobic culture appropriate only if sheathed (protected) catheter used

Special Instructions

,2 hrs/RT

,15 min, RT without transport media; ,2 hrs/RT using transport media

,2 hrs/RT

,2 hrs/RT

Transportation to Laboratory

24 hrs/RT

24 hrs/RT

24 hrs/4°C

24 hrs/4°C

Storage Before Processing

BA or SSA

BA, CA, chromogenic agar

BA, CA, Mac, PC, OFPBLcystic fibrosis

BA, CA, Mac, CNA

Primary Plating Media

Gram and other special stains as requested (e.g., Legionella DFA, acid-fast stain)

Gram and other special stains as requested (e.g., Legionella DFA, acid-fast stain)

Direct Examination

TABLE Collection, Transport, Storage, and Processing of Specimens Commonly Submitted to a Microbiology Laboratory—cont'd 5-1

Other considerations: add special media for C. diphtheriae, Neisseria gonorrhoeae, and epiglottis (Haemophilus influenzae)

Other considerations: add special media for Corynebacterium diphtheriae, pertussis, Chlamydia, and Mycoplasma

Other considerations: AFB, Nocardia

Other considerations: quantitative culture for BAL, AFB, Legionella, Nocardia, Mycoplasma, Pneumocystis, Cytomegalovirus

Comments

64 PA RT I I  General Principles in Clinical Microbiology

Tissue Anaerobic transporter or sterile, screw-cap tube

Disinfect skin.

Clean-voided midstream (CVS)

Sterile, screw-cap container Containers that include a variety of chemical urinalysis preservatives may also be used.

Females: clean area with soap and water, then rinse with water; hold labia apart and begin voiding in commode; after several mL have passed, collect midstream. Males: clean glans with soap and water, then rinse with water; retract foreskin; begin voiding in commode; after several mL have passed, collect midstream.

Straight catheter (in and out)

Sterile, screw-cap container

Clean urethral area (soap and water) and rinse (water).

Suprapubic aspirate

Sterile, screwcap container or anaerobic transporter

Disinfect skin.

Do not allow specimen to dry out; moisten with sterile, distilled water if not bloody.

,15 min/RT

24 hrs/RT

BA, CA, Mac, CNA, Thio; Anaerobic: BBA, LKV, BBE

Gram

May need to homogenize

Preserved within 24 hrs/ RT Unpreserved ,2 hrs/RT

24 hrs/4°C

BA, Mac Optional: chromogenic agar

Check for pyuria, Gram stain not recommended

Plate quantitatively at 1:1000; consider plating quantitatively at 1:100 if patient is a female of childbearing age with white blood cells and possible acute urethral syndrome

Insert catheter into bladder; allow first 15 mL to pass; then collect remainder.

,2 hrs/RT Preserved , 24 hrs/RT

24 hrs/4°C

BA, Mac

Gram or check for pyuria

Plate quantitatively at 1:100 and 1:1000 Culture of Foley catheters is not recommended.

Needle aspiration above the symphysis pubis through the abdominal wall into the full bladder.

Immediately/RT

Plate as soon as received

BA, Mac, Ana, Thio

Gram or check for pyuria

Plate quantitatively at 1:100 and 1:1000

Urine

CHAPTER 5  Specimen Management

65

7H10, Middlebrook 7H10 agar; AFB, acid-fast bacilli; AM, morning; Ana, anaerobic agars as appropriate (see Chapter 41); AO, acridine orange stain; BA, blood agar; BAL, bronchial alveolar lavage; BB, bronchial brush; BBA, brucella blood agar; BBE, Bacteroides bile esculin agar; BHI, brain heart infusion agar; BW, bronchial wash; CA, chocolate agar; Campy, selective Campylobacter agar; CNA, Columbia agar with colistin and nalidixic acid; CW, calcofluor white stain; DFA, direct fluorescent antibody stain; EB, enrichment broth; GC, Neisseria gonorrhoeae; GI, gastrointestinal; Gram, Gram stain; H&E, hematoxylin and eosin; HE, Hektoen enteric agar; IMAcg, inhibitory mold agar with chloramphenicol and gentamicin; IUD, intrauterine device; LKV, laked blood agar with kanamycin and vancomycin; Mac, MacConkey agar; Mac-S, MacConkey-sorbitol; OFPBL, oxidative-fermentative polymyxin B-bacitracin-lactose-agar; O&P, ova and parasite examination; PC, Pseudomonas cepacia agar; PVA, polyvinyl alcohol; RT, room temperature; SDA, Sabouraud dextrose agar; SDAcg, Sabouraud dextrose agar with cycloheximide and gentamicin; SPS, sodium polyanethol sulfonate; SSA, group A streptococcus selective agar; thio, thioglycollate broth; TM, Thayer-Martin agar; XLD, xylose lysine deoxycholate agar. *Specimens for viruses, chlamydia, and mycoplasma are usually submitted in appropriate transport media at 4°C to stabilize respective microorganisms.

66 PA RT I I  General Principles in Clinical Microbiology

• Figure 5-1  Specimen

bag with biohazard label, separate pouch for paperwork, and self-seal. (Courtesy Allegiance Healthcare Corp., McGaw Park, Ill.)

Specimen Labeling Specimens should be labeled with the patient’s name, identifying number (hospital or sample number), birth date, date and time of collection, source, and the initials of the individual that collected the sample. Enough information must be provided on the specimen label so that the specimen can be matched up with the test requisition when it is received in the laboratory.

Specimen Requisition The specimen (or test) requisition is an order form that is sent to the laboratory along with a specimen. Often the requisition is a hard (paper) copy of the physician’s orders and the patient’s demographic information (e.g., name and hospital number). Sometimes, however, if a hospital information system offers computerized order entry, the requisition is transported to the laboratory electronically. The requisition should contain as much information as possible regarding the patient history and diagnosis. This information helps the microbiologist to work up the specimen and determine which organisms are significant in the culture. A complete requisition should include the following: • The patient’s name • Hospital identification number • Age and date of birth • Sex • Collection date and time • Ordering physician • Exact nature and source of the specimen • Diagnosis (may be ICD-10-CM code) • Current antimicrobial therapy

Rejection of Unacceptable Specimens Criteria for specimen rejection should be set up and distributed to all clinical practitioners. In general, specimens

are unacceptable if any of the following conditions apply: • The information on the label does not match the information on the requisition or the specimen is not labeled at all (patient’s name or source of specimen is different). • The specimen has been transported at the improper temperature. • The specimen has not been transported in the proper medium (e.g., specimens for anaerobic bacteria submitted in aerobic transports). • The quantity of specimen is insufficient for testing (the specimen is considered quantity-not-sufficient [QNS]). • The specimen is leaking. • The specimen transport time exceeds 2 hours postcollection or the specimen is not preserved. • The specimen was received in a fixative (formalin), which, in essence, kills any microorganism present. • The specimen has been received for anaerobic culture from a site known to have anaerobes as part of the normal microbiota (vagina, mouth). • The specimen is dried. • Processing the specimen would produce information of questionable medical value (e.g., Foley catheter tip). It is important to always talk to the requesting physician or another member of the health care team before discarding unacceptable specimens. This is particularly important if the specimen was collected using an invasive technique such as a surgical biopsy and collection of a new specimen would be difficult or impossible. In these cases, mislabeling of a specimen or requisition may be corrected by having the person who collected the specimen and filled out the paperwork come to the laboratory and correct the problem; a mislabeled specimen or requisition should not be identified over the telephone. However, correction of mislabeled specimens must be completed at the discretion of the laboratory’s standard operating procedures. It is often necessary to do the best possible job on a less than optimal specimen if it would be impossible to collect the specimen again because the patient is taking antibiotics, the tissue was collected at surgery, or the patient would have to undergo a second invasive procedure (bone marrow or spinal tap). A notation regarding improper collection should be added to the final report in this instance, because only the primary caregiver is able to determine the validity of the results.

Specimen Processing Depending on the site of testing (hospital, independent laboratory, physician’s office laboratory) and how the specimens are transported to the laboratory (in-house, courier, or driver), microbiology samples may arrive in the laboratory in large numbers or as single tests. Although batch processing may be possible in large independent laboratories, hospital testing is typically performed as specimens arrive. When multiple specimens arrive at the same time, priority should be given to those that are most

CHAPTER 5  Specimen Management

critical, such as cerebrospinal fluid (CSF), tissue, blood, and sterile fluids. Urine, throat, sputa, stool, or wound drainage specimens can be saved for later. On arrival in the laboratory, the time and date received should be recorded. Acid-fast, viral, and fungal specimens are usually batched for processing. When a specimen is received with multiple requests but the amount of specimen is insufficient to do all of them, the microbiologist should call the clinician to prioritize the testing. Any time a laboratory staff member contacts the physician or nurse, the conversation and agreed-upon information should be documented to ensure proper follow-up.

Gross Examination of Specimen All processing should begin with a gross examination of the specimen. Areas with blood or mucus should be located and sampled for culture and direct examination. Stool should be examined for evidence of barium (i.e., chalky white color), which would preclude O&P examination. Notations should be made on the handwritten or electronic work card regarding the status of the specimen (e.g., bloody, cloudy, clotted) so that if more than one person works on the sample, the results of the gross examination are available for consultation.

Direct Microscopic Examination All appropriate specimens should have a direct microscopic examination (smear of the primary specimen). The direct examination serves several purposes. First, the quality of the specimen can be assessed; for example, sputa can be rejected that represent saliva and not lower respiratory tract secretions by quantitation of white blood cells or squamous epithelial cells present in the specimen. Second, the microbiologist and clinician can be given an early indication of what may be wrong with the patient (e.g., 41 gram-positive cocci in clusters in an exudate). Third, the workup of the specimen can be guided by comparing what grows in culture to what was seen on the original smear. A situation in which three different morphotypes (cellular types) are seen on direct Gram stain but only two grow out in culture, for example, alerts the microbiologist to the fact that the third organism may be an anaerobic bacterium. If there were more than three organisms on the culture plate that were not visible on Gram stain, this would indicate possible contamination. Gram stains are often also layered with cells and debris. Organisms that appear on the surface of white blood cells may actually be ingested organisms that are no longer viable or capable of growth. It is imperative that the Gram stain results and specimen culture correlate to the type of specimen to ensure accurate information is provided to the clinician. Direct examinations are usually not performed on throat, nasopharyngeal, or stool specimens because of the presence of abundant normal microbiota but are indicated from most other sources.

67

The most common stain in bacteriology is the Gram stain, which helps the clinician to visualize rods, cocci, white blood cells, red blood cells, or squamous epithelial cells present in the sample. The most common direct fungal stains are KOH (potassium hydroxide), PAS (periodic-acid Schiff), GMS (Grocott’s methenamine silver stain), and calcofluor white. Although rarely used in the clinical laboratory, the most common direct acid-fast stains are AR (auramine rhodamine), ZN (Ziehl-Neelsen), and Kinyoun. Chapter 6 describes the use of microscopy in clinical diagnosis in more detail.

Selection of Culture Media Primary culture media are divided into several categories. The first are nutritive media, such as blood or chocolate agars. Nutritive media support the growth of a wide range of microorganisms and are considered nonselective because, theoretically, the growth of most organisms is supported. Nutritive media can also be differential, in that microorganisms can be distinguished on the basis of certain growth characteristics evident on the medium. Blood agar is considered both a nutritive and differential medium because it differentiates organisms based on whether they are alpha (a)-, beta (b)-, or gamma (g)-hemolytic (Figure 5-2). Selective media support the growth of one group of organisms but not another by adding antimicrobials, dyes, or alcohol to a particular medium. MacConkey agar, for example, contains the dye crystal violet, which inhibits gram-positive organisms. Columbia agar with colistin and nalidixic acid (CNA) is a selective medium for gram-positive organisms, because the antimicrobials colistin and nalidixic acid inhibit gramnegative organisms. Selective media can also be differential media if, in addition to their inhibitory activity, they differentiate between groups of organisms. MacConkey agar, for example, differentiates between lactose-fermenting and nonfermenting gram-negative rods by the color of the colonial growth (pink or clear, respectively); this is shown in Figure 5-3. In some cases (sterile body fluids, tissues, or deep abscesses in a patient receiving antimicrobial therapy), backup broth (also called supplemental or enrichment broth) medium is inoculated, along with primary solid (agar) media, so small numbers of organisms present may be detected; this allows detection of anaerobes in aerobic cultures and organisms that may be damaged by either previous or concurrent antimicrobial therapy. Thioglycollate (thio) broth, brain-heart infusion broth (BHIB), and tryptic soy broth (TSB) are common backup broths. Selection of media to inoculate for any given specimen is usually based on the organisms most likely to be involved in the disease process. For example, in determining what to set up for a CSF specimen, one considers the most likely pathogens that cause meningitis (Streptococcus pneumoniae, Haemophilus influenzae, Neisseria meningitidis, Escherichia coli, group B streptococcus) and selects media that will support the growth of these organisms (blood and chocolate agar at a minimum). Likewise, if a specimen is collected from a

68 PA RT I I  General Principles in Clinical Microbiology

A

B

C • Figure 5-2  Examples

of various types of hemolysis on blood agar. A, Streptococcus pneumoniae showing alpha (a)-hemolysis (i.e., greening around colony). B, Staphylococcus aureus showing beta (b)-hemolysis (i.e., clearing around colony). C, Enterococcus faecalis showing gamma (g)-hemolysis (i.e., no hemolysis around colony).

A

B • Figure 5-3  MacConkey agar. A, Escherichia coli, a lactose fermenter. B, Pseudomonas aeruginosa, a nonlactose fermenter.

CHAPTER 5  Specimen Management

source likely to be contaminated with normal microbiota, for example, an anal fistula (an opening of the surface of the skin near the anus that may communicate with the rectum), the laboratorian might want to add a selective medium, such as CNA, to suppress gram-negative bacteria and allow gram-positive bacteria and yeast to be recovered. Routine primary plating media and direct examinations for specimens commonly submitted to the microbiology laboratory are shown in Table 5-1. Chapter 7 on bacterial cultivation reemphasizes the strategies for selection and use of bacterial media.

Specimen Preparation Many specimens require some form of initial treatment before inoculation onto primary plating media. Such procedures include homogenization (grinding or mincing) of tissue; concentration by centrifugation or filtration of large volumes of sterile fluids, such as ascites (peritoneal) or pleural (lung) fluids; or decontamination of respiratory specimens, such as those for legionellae or mycobacteria. Traditional fiber swab specimens have an internal mattress core that can trap organisms and may be vortexed (mixed) in 0.5 to 1 mL of saline or broth for 10 to 20 seconds to dislodge material from the fibers. Flocked swabs contain no mattress core. The fibers are designed to ionically bind the negative charges on the surface of cells (Copan Diagnostics, Murrieta, CA). Therefore the swabs require no processing that potentially can lead to the complete loss or decrease in recovery of the organisms.

Inoculation on Solid Media Specimens can be inoculated (plated) onto solid media either quantitatively by a dilution procedure or by means of a quantitative loop, or semiquantitatively using an ordinary inoculating loop. Urine cultures and tissues from burn victims are plated quantitatively; everything else is usually plated semiquantitatively. Plates inoculated for quantitation are usually streaked with a 1:100 or 1:1000 loop. Plates inoculated for semiquantitation are usually streaked out in four quadrants. Detailed methods for streaking solid media are provided in Chapter 7, Figure 7-9. Semiquantitation is referred to as streaking for isolation, because the microorganisms present in the specimen are successively diluted out as each quadrant is streaked until finally each morphotype is present as a single colony. Numbers of organisms present can subsequently be graded as 41 (many, heavy growth) if growth is out to the fourth quadrant, 31 (moderate growth) if growth is out to the third quadrant, 21 (few or light growth) if growth is in the second quadrant, and 11 (rare) if growth is in the first quadrant. This tells the clinician the relative numbers of different organisms present in the specimen; such semiquantitative information is usually sufficient for the physician to be able to treat the patient.

69

Incubation Conditions Inoculated media are incubated under various temperatures and environmental conditions, depending on the organisms suspected—for example, 28° to 30°C for fungi and 35° to 37°C for most bacteria, viruses, and acid-fast bacillus. A number of different environmental conditions exist. Aerobes grow in ambient air, which contains 21% oxygen (O2) and a small amount (0.03%) of carbon dioxide (CO2). Anaerobes usually cannot grow in the presence of O2, and the atmosphere in anaerobe jars, bags, or chambers is composed of 5% to 10% hydrogen (H2), 5% to 10% CO2, 80% to 90% nitrogen (N2), and 0% O2. Capnophiles, such as Haemophilus influenzae and Neisseria gonorrhoeae, require increased concentrations of CO2 (5% to 10%) and approximately 15% O2. This atmosphere can be achieved by a candle jar (3% CO2) or a CO2 incubator, chamber jar, or bag. Microaerophiles (Campylobacter jejuni, Helicobacter pylori) grow under reduced O2 (5% to 10%) and increased CO2 (8% to 10%). This environment can also be obtained in specially designed chamber jars or bags. Both anaerobic and microaerophilic environments may be produced using an automated microprocessor-controlled system, the Advanced Axonomat, to create the desired atmospheric balance of gases required for specific organismal growth (Advanced Instruments, Norwood, MA). More detailed information is included in Chapter 40.

Specimen Workup One of the most important functions that a microbiologist performs is deciding what is clinically relevant regarding specimen workup. Considerable judgment is required to decide what organisms to look for and report. It is essential to recognize what constitutes indigenous (normal) microbiota and what constitutes a potential pathogen. Indiscriminate identification, susceptibility testing, and reporting of normal microbiota can contribute to unnecessary use of antibiotics and potential emergence of resistant organisms. Because organisms that are clinically relevant to identify and report vary by source, the microbiologist should know which organisms cause disease at various sites. Part VII contains a detailed discussion of these issues.

Extent of Identification Required As health care continues to change, one of the most problematic issues for microbiologists is the extent of culture workup. Microbiologists still rely heavily on definitive identification, although shortcuts, including the use of limited identification procedures in some cases, are becoming commonplace in most clinical laboratories (see CLSI document M35-A2 for information on abbreviated identification of organisms). Careful application of knowledge of the significance of various organisms in specific situations and thoughtful use of limited approaches will keep microbiology testing

70 PA RT I I  General Principles in Clinical Microbiology

cost effective and the laboratory’s workload manageable, while providing for optimum patient care. Complete identification of a blood culture isolate, such as Clostridium septicum as opposed to a genus identification of Clostridium spp., will alert the clinician to the possibility of malignancy or other disease of the colon. At the same time, a presumptive identification of Escherichia coli if a gram-negative, spot indole-positive rod is recovered with appropriate colony morphology on MacConkey agar (flat, lactose-fermenting colony that is precipitating bile salts) is probably permissible from an uncomplicated urinary tract infection. In the final analysis, culture results should always be compared with the suspected diagnosis. The clinician should be encouraged to supply the microbiologist with all pertinent information (e.g., recent travel history, pet exposure, pertinent radiograph findings) so that the microbiologist can use the information to interpret culture results and plan appropriate strategies for workup.

Communication of Laboratory Findings To fulfill their professional obligation to the patient, microbiologists must communicate their findings to those health care professionals responsible for treating the patient. This task is not as easy as it may seem. This is nicely illustrated in a study in which a group of physicians was asked whether they would treat a patient with a sore throat given two separate laboratory reports—that is, one that stated, “many group A streptococci,” and one that stated, “few group A streptococci.” Although group A streptococcus (Streptococcus pyogenes) is considered significant in any numbers in a symptomatic individual, the physicians said that they would treat the patient with many organisms but not the one with few organisms. Thus although a pathogen (group A streptococcus) was isolated in both cases, one word on the report (either many or few) made a difference in how the patient would be treated. In communicating with the physician, the microbiologist can prevent confusion and misunderstanding by not using jargon or abbreviations and by providing reports with clearcut conclusions. The microbiologist should not assume that the clinician is fully familiar with laboratory procedures or the latest microbial taxonomic schemes. Thus when appropriate, interpretive statements should be included in the written report along with the specific results. One example would be the addition of a statement such as “suggests contamination at collection” when more than three organisms are isolated from a clean-voided midstream urine specimen. Laboratory newsletters should be used to provide physicians with material such as details of new procedures, nomenclature changes, and changes in usual antimicrobial susceptibility patterns of frequently isolated organisms. This last information, discussed in more detail in Chapter 11, is very useful to clinicians when selecting empiric therapy. Empiric therapy is based on the physician determining the most likely organism causing a patient’s clinical symptoms and then selecting an antimicrobial that, in the past, has

worked against that organism in a particular hospital or geographic area. Empiric therapy is used to initiate treatment before the results of the patient’s culture are known and may be critical to the patient’s well-being in cases of lifethreatening illnesses. Positive findings should be communicated to the clinician in a timely manner, and all verbal reports should be followed by written confirmation of results. Results should be legibly handwritten or generated electronically in the laboratory information system (LIS).

Critical (Panic) Values Certain critical results must be communicated to the clinician immediately. Each clinical microbiology laboratory, in consultation with its medical staff, should prepare a list of these so-called “panic values.” Common panic values include the following: • Positive blood cultures • Positive spinal fluid Gram stain or culture • Streptococcus pyogenes (group A streptococcus) in a surgical wound • Gram stain suggestive of gas gangrene (large boxcarshaped gram-positive rods) • Blood smear positive for malaria • Positive cryptococcal antigen test • Positive acid-fast stain • Detection of a select agent (e.g., Brucella) or other significant pathogen (e.g., Legionella, vancomycin-resistant S. aureus, or other antibiotic-resistant organisms as outlined by the facility and infection control policies).

Expediting Results Reporting: Computerization Before widespread computerization of clinical microbiology laboratories, results were communicated via handwritten reports, and couriers delivered hard copies that were pasted into the patient’s chart. Today, microbiology computer software is available that simplifies and speeds up this task. Central processing units (CPUs), large computer servers, controllers, printers, video terminals, communication ports, modems, and other types of hardware support running the software. The hardware and software together make up the complete LIS. Many LIS systems are, in turn, interfaced with a hospital information system (HIS). Between the HIS and LIS, most functions involved in ordering and reporting laboratory tests can be handled electronically. Order entry, patient identification, and specimen identification can be handled using the same type of bar coding that is commonly used in supermarkets. The LIS also takes care of result reporting and supervisory verification of results, stores quality control data, allows easy test inquiries, and assists in test management reporting by storing, for example, the number of positive, negative, and unsatisfactory specimens. Most large systems also are capable of interfacing (communicating) with microbiology

CHAPTER 5  Specimen Management

instruments to automatically download (transfer) and store data regarding positive cultures or antimicrobial susceptibility results. Results of individual organism antibiograms (patterns) can then be retrieved monthly so hospital-wide susceptibility patterns can be studied for the emergence of resistant organisms or other epidemiologic information. Many vendors of laboratory information systems are now housed on computer servers adapting the use of the LIS to personal computers (PCs) so that large CPUs are no longer needed. Today, small systems can be interfaced with printers or electronic facsimile machines (faxes) as well as accessed through smart phones or tablets for quick and easy reporting and information retrieval, further improving the quality of patient care. Visit the Evolve site for a complete list of procedures, review questions, and case study answers.

71

Bibliography Bennett J, Dolin R, Blaser M: Principles and practice of infectious diseases, ed 8, Philadelphia, PA, 2015, Elsevier Saunders. Daley P, Castricianao S, Chernesky M, Smiej M: Comparison of flocked and rayon swabs for collection of respiratory epithelial cells from uninfected volunteers and symptomatic patients, J Clin Microbiol 44:2265, 2006. Jorgensen J, Pfaller M, Carroll K, et al. Manual of clinical microbiology, ed 11, Washington, DC, 2015, ASM Press. Lee A, McLean S: The laboratory report: a problem in communication between clinician and microbiologist? Med J Aust 2:858, 1977.

SECTION 2   Approaches to Diagnosis of Infectious Diseases

6

Role of Microscopy

OBJECTIVES 1. Explain the role of microscopy in the identification of etiologic agents, including bacteria, fungi, viruses, and parasites. 2. List the four major types of microscopic techniques available for diagnostic evaluation in the clinical laboratory, explain their basic principles, and list a clinical application for each. 3. Define the three main principles of light microscopy, magnification, resolution, and contrast. 4. List the staining techniques used to aid in the visualization of bacteria, explain the chemical principle and limitations for each, and provide an example of a clinical application for each stain. Include the following stains: Gram stain, the Kinyoun stain, the Ziehl-Neelsen stain, the calcofluor white stain, the Acridine orange stain, and the AuramineRhodamine stain. 5. Explain the chemical principle for fluorescent dyes in microscopy, and list two examples routinely used in the clinical laboratory. 6. Describe the purpose and method for Kohler illumination.

T

he basic flow of procedures involved in the laboratory diagnosis of infectious diseases is as follows: 1. Direct examination of patient specimens for the presence of etiologic agents 2. Growth and cultivation of the agents from the specimens 3. Analysis of the cultivated organisms to establish their identification and other pertinent characteristics such as susceptibility to antimicrobial agents For certain infectious diseases, this process may also include measuring the patient’s immune response to the infectious agent. Microscopy is the most common method used both for the detection of microorganisms directly in clinical specimens and for the characterization of organisms grown in culture (Box 6-1). Microscopy is defined as the use of a microscope to magnify (i.e., visually enlarge) objects too small to be visualized with the naked eye so that their characteristics are readily observable. Because most infectious agents cannot be detected with the unaided eye, microscopy plays a pivotal role in the laboratory.

72

FPO Optional Photo/Art Inset (10p x 10p)

Microscopes and microscopic methods vary. Those of primary use in diagnostic microbiology include bright-field (light) microscopy, phase contrast, fluorescent, and darkfield microscopy. The method used to process patient specimens is dictated by the type and body source of the specimen (see Part VII). Regardless of the method used, some portion of the specimen usually is reserved for microscopic examination. Specific stains or dyes applied to the specimens, combined with particular methods of microscopy, can detect etiologic agents in a rapid, relatively inexpensive, and productive way. Microscopy also plays a key role in the characterization of organisms that have been cultivated in the laboratory (for more information regarding cultivation of bacteria, see Chapter 7). The types of microorganisms to be detected, identified, and characterized determine the most appropriate types of microscopy to use. Table 6-1 outlines the basic types of microscopy and their relative utility for each of the four major types of infectious agents. Bright-field microscopy (also known as light microscopy) and fluorescence microscopy have the widest use and application within the clinical microbiology laboratory. Dark-field and electron microscopes are not typically found within a clinical laboratory and are predominantly used in reference or research settings. Because of advances in technology, all types of microscopy are now available in formats that take advantage of virtual or digital imaging for the acquisition and transmission of images. The microorganisms that can be detected or identified by each microscopic method also depends on the methods used to highlight the microorganisms and their key characteristics. This enhancement is usually achieved using various dyes or stains.

Bright-Field (Light) Microscopy Principles of Light Microscopy For bright-field (light) microscopy, visible light is passed through the specimen and then through a series of lenses that bend the light in a manner that results in magnification of the organisms present in the specimen (Figure 6-1). The total magnification achieved is the product of the lenses used.

CHAPTER 6  Role of Microscopy

• BOX 6-1

Magnification

Applications of Microscopy in Diagnostic Microbiology

• Rapid preliminary organism identification by direct visualization in patient specimens • Rapid final identification of certain organisms by direct visualization in patient specimens • Detection of different organisms present in the same specimen • Detection of organisms not easily cultivated in the laboratory • Evaluation of patient specimens for the presence of cells indicative of inflammation (i.e., phagocytes) or contamination (i.e., squamous epithelial cells) • Determination of an organism’s clinical significance; bacterial contaminants usually are not present in patient specimens at sufficiently high numbers (3105 cells/mL) to be seen by light microscopy • Preculture information about which organisms might be expected to grow so that appropriate cultivation techniques are used • Determination of which tests and methods should be used for identification and characterization of cultivated organisms • A method for investigating unusual or unexpected laboratory test results

Magnified image

In most light microscopes, the objective lens, which is closest to the specimen, magnifies objects 1003 (times), and the ocular lens, which is nearest the eye, magnifies 103. Using these two lenses in combination (total magnification), organisms in the specimen are magnified 10003 their actual size when viewed through the ocular lens. Objective lenses of lower magnification are available so that those of 103, 203, and 403 magnification power can provide total magnifications of 1003, 2003, and 4003, respectively. Magnification of 10003 allows for the visualization of fungi, most parasites, and most bacteria, but it is not sufficient for observing viruses, which require magnification of 100,0003 or more (see Electron Microscopy in this chapter).

Resolution To optimize visualization, other factors besides magnification must be considered. Resolution, defined as the extent to which detail in the magnified object is maintained, is also essential. Without it everything would be magnified as an indistinguishable blur. Therefore resolving power, which is Ocular lens

Eye

Ocular lens Oil immersion objective lens Specimen on slide

Immersion oil Stage

Objective lens Specimen

Condenser lens Condenser lens

Light

Magnification

Light source

Light path

Microscope components

• Figure 6-1  Principles of bright-field (light) microscopy. (Modified from Atlas RM: Principles of microbiology, St. Louis, 2006, Mosby.)

TABLE Microscopy for Diagnostic Microbiology 6-1

Organism Group

Bright-Field Microscopy

Digital Microscopy

Fluorescence Microscopy

Phase-Contrast Microscopy

Dark-Field Microscopy

Electron Microscopy

Bacteria

1

1

1

1

6

2

Fungi

1

1

1

1

2

2

Parasites

1

1

1

1

2

6

Viruses

2

1

1

2

2

6

1, Commonly used; 6, limited use; 2, rarely used.

73

74 PA RT I I   General Principles in Clinical Microbiology

the closest distance between two objects that when magnified still allows the two objects to be distinguished from each other, is extremely important. The resolving power of most light microscopes allows bacterial cells to be distinguished from one another but usually does not allow bacterial structures, internal or external, to be detected. To achieve the level of resolution desired with 10003 magnification, oil immersion must be used in conjunction with light microscopy. Immersion oil has specific optical and viscosity characteristics designed for use in microscopy. Immersion oil is used to fill the space between the objective lens and the glass slide onto which the specimen has been affixed. When light passes from a material of one refractive index to a material with a different refractive index, as from glass to air, the light bends. Light of different wavelengths bends at different angles, creating a less distinct, distorted image. Placing immersion oil with the same refractive index as glass between the objective lens and the coverslip or slide decreases the number of refractive surfaces the light must pass through during microscopy. The oil enhances resolution by preventing light rays from dispersing and changing wavelength after passing through the specimen. A specific objective lens, the oil immersion lens, is designed for use with oil; this lens provides 1003 magnification on most light microscopes. Lower magnifications (i.e., 1003 or 4003) may be used to locate specimen samples in certain areas on a microscope slide or to observe microorganisms such as some fungi and parasites. The 10003 magnification provided by the combination of ocular and oil immersion lenses usually is required for optimal detection and characterization of bacteria.

Contrast The third key component to light microscopy is contrast, which is needed to make objects stand out from the background. Because microorganisms are essentially transparent, because of their microscopic dimensions and high water content, they cannot be easily detected among the background materials and debris in patient specimens. Lack of contrast is also a problem for the microscopic examination of microorganisms grown in culture. Contrast is most commonly achieved by staining techniques that highlight organisms and allow them to be differentiated from one another and from background material and debris. In the absence of staining, the simplest way to improve contrast is to reduce the diameter of the microscope aperture diaphragm, increasing contrast at the expense of the resolution. Setting the controls for brightfield microscopy requires a procedure referred to as setting the Kohler illumination (Evolve Procedure 6-1).

white blood cells, epithelial cells, and predominant organism type. Occasionally an organism may grow in culture that was not seen in the direct smear. There are a variety of potential reasons for this, including the possibility that a slow-growing organism was present, the patient was receiving antibiotic treatment to prevent growth of the organism, the specimen was not processed appropriately and the organisms are no longer viable, or the organism requires special media for growth. Preparation of an indirect smear indicates that the primary sample has been processed in culture and the smear contains organisms obtained after purification or growth on artificial media. Indirect smears may include preparation from solid or semisolid media or broth. Care should be taken to ensure the smear is not too thick when preparing the slide from solid media. In addition, smear from a liquid broth should not be diluted. Liquid broth cultures result in smears that more clearly and accurately represent the native cellular morphology and arrangement compared with smears from solid media. Details of specimen processing are presented throughout Part VII, and in most instances the preparation of every specimen includes the application of some portion of the specimen to a clean glass slide (i.e., “smear” preparation) for subsequent microscopic evaluation. Generally, specimen samples are placed on the slide using a swab or a direct smear that contains patient material or by using a pipette into which liquid specimen has been aspirated (Figure 6-2). Material to be stained is dropped (if liquid) or rolled (if on a swab) onto the surface of a clean, dry, glass slide. To prevent contamination of culture media, once a swab has touched the surface of a nonsterile slide, it should not be used for subsequently inoculating media. For staining microorganisms grown in culture or an indirect smear, a sterile loop or needle may be used to transfer a small amount of growth from a solid medium to the surface of the slide. This material is emulsified in a drop of sterile water or saline on the slide. For small amounts of growth that

A

Direct and Indirect Smears Staining methods are either used directly with patient specimens or are applied to preparations made from microorganisms grown in culture. A direct smear is a preparation of the primary clinical sample received in the laboratory for processing. A direct smear provides a mechanism to identify the number and type of cells present in a specimen, including

B • Figure 6-2  Smear

preparations by swab roll (A) and pipette deposition (B) of a patient specimen on a glass slide.

CHAPTER 6  Role of Microscopy

might become lost in even a drop of saline, a sterile wooden applicator stick can be used to touch the growth; this material is then rubbed directly onto the slide, where it can be easily seen. The material placed on the slide to be stained is allowed to air-dry and is affixed to the slide by placing it on a slide warmer (60° C) for at least 10 minutes or by flooding it with 95% methanol for 1 minute. Smears should be air-dried completely before heat fixing to prevent the distortion of cell shapes before staining. To examine organisms grown in liquid medium, an aspirated sample of the broth culture is applied to the slide, air-dried, and fixed before staining. A squash or crush prep may be used for a tissue, bone marrow aspirate, or other aspirated sample. The aspirate may be placed in the anticoagulant ethylenediaminetetraacetic acid (EDTA) tube and inverted several times to mix the contents. This prevents clotting of the aspirated material. To prepare the slide, a drop of the aspirate is placed on a slide and a second slide is gently placed on top; the two slides are pressed together, crushing or squashing any particulate matter. The two slides are then gently slid or pulled apart using a horizontal motion and air-dried before staining. A cytocentrifugation or concentration of a sterile body fluid such as cerebral spinal fluid (CSF) enhances the ability to identify cells in a specimen that may contain small numbers of microorganisms. In a cytocentrifuge, the hydraulic forces of the liquid cause the fluid to move away from the sediment, which is then collected on an absorbent material, leaving the particulate matter and cellular debris in the center of the microscope slide. The slide may then be stained for microscopy. A fresh or well-preserved specimen and the absence of interfering material are the two primary factors that affect the quality of the preparation using a cytocentrifuge. If the specimen is too old, the biologic cells may have disintegrated, resulting in a high protein content or background material. If the sample contains numerous cells, such as in a bloody spinal tap, the organisms may be indistinguishable from the background material. Smear preparation varies depending on the type of specimen being processed (see the chapters in Part VII that discuss specific specimen types) and on the staining methods to be used. Nonetheless, the general rule for smear preparation is that sufficient material must be applied to the slide so that the chances for detecting and distinguishing microorganisms are maximized. At the same time, the application of excessive material that could interfere with the passage of light through the specimen or that could distort the details of microorganisms must be avoided. Finally, the staining methods used to visualize the contents of the smear are dictated by which microorganisms are suspected in the specimen.

Staining Techniques As listed in Table 6-1, light microscopy has applications for bacteria, fungi, and parasites. However, the stains used for these microbial groups differ extensively. Those primarily designed for examination of parasites and fungi by light microscopy are discussed in Chapters 46 and 58, respectively.

75

The stains for microscopic examination of bacteria, the Gram stain and the acid-fast stains, are discussed here.

Gram Stain The Gram stain is the principal stain used for microscopic examination of bacteria and is one of the most important bacteriologic techniques within the microbiology laboratory. Gram staining provides a mechanism for the rapid presumptive identification of pathogens, and it gives important clues related to the quality of a specimen and whether bacterial pathogens from a specific body site are considered normal microbiota colonizing the site or the actual cause of infection. Nearly all clinically important bacteria can be detected using this method, the only exceptions being those organisms that exist almost exclusively within host cells (e.g., chlamydia), those that lack a cell wall (e.g., mycoplasma and ureaplasma), and those of insufficient dimension to be resolved by light microscopy (e.g., spirochetes). First devised by Hans Christian Gram during the late nineteenth century, the Gram stain can be used to divide most bacterial species into two large groups: those that take up the basic dye, crystal violet (i.e., gram-positive bacteria), and those that allow the crystal violet dye to wash out easily with the decolorizer alcohol or acetone (i.e., gram-negative bacteria). Therefore the Gram stain is considered a differential stain, based on the chemical differentiation of organisms as a result of the structural chemical components of the organism’s cell wall. Procedure Overview

Although modifications of the classic Gram stain that involve changes in reagents and timing exist, the principles and results are the same for all modifications. The classic Gram stain procedure entails fixing clinical material to the surface of the microscope slide, either by heating or by using methanol. Methanol fixation preserves the morphology of host cells, as well as bacteria, and is especially useful for examining bloody specimens. Slides are overlaid with 95% methanol for 1 minute; the methanol is allowed to run off, and the slides are air-dried before staining. After fixation, the first step in the Gram stain is the application of the primary stain, crystal violet (CV). A mordant, Gram’s iodine (I), is applied after the crystal violet to chemically bond the alkaline dye to the iodine, forming a CV-I complex and cross-linking the complex in the bacterial cell wall. The decolorization step distinguishes gram-positive from gram-negative cells. Therefore after decolorization, organisms that stain gram-positive retain the crystal violet and those that are gram-negative are cleared of crystal violet. Addition of the secondary stain or counterstain safranin will then stain the colorless gram-negative bacteria pink or red (Figure 6-3). See Evolve Procedure 6-2 for detailed methodology, expected results, and limitations. Principle

The difference in composition between gram-positive cell walls, which contain thick peptidoglycan with numerous teichoic acid cross-linkages, and gram-negative cell walls, which consist of a thinner layer of peptidoglycan and an

76 PA RT I I   General Principles in Clinical Microbiology

Gram+ bacteria

1

Steps for staining

Grambacteria

Cells on slide

2

Primary stain (crystal violet) Stain purple

3

Stain purple Mordant (Gram’s iodine)

Remain purple 4 Remain purple 5

Remain purple Decolorizer, (alcohol and/or acetone)

Become colorless

Counterstain (safranin) Remain purple

Stain pink

1 Fix material on slide with methanol or heat. If slide is heat fixed, allow it to cool to the touch before applying stain. 2 Flood slide with crystal violet (purple) and allow it to remain on the surface without drying for 10 to 30 seconds. Rinse the slide with tap water, shaking off all excess. 3 Flood the slide with iodine to increase affinity of crystal violet and allow it to remain on the surface without drying for twice as long as the crystal violet was in contact with the slide surface (20 seconds of iodine for 10 seconds of crystal violet, for example). Rinse with tap water, shaking off all excess. 4 Flood the slide with decolorizer for 10 seconds or less (optimal decolorization depends on chemical used) and rinse off immediately with tap water. Repeat this procedure until the blue dye no longer runs off the slide with the decolorizer. Thicker smears require more prolonged decolorizing. Rinse with tap water and shake off excess. 5 Flood the slide with counterstain and allow it to remain on the surface without drying for 30 seconds. Rinse with tap water and gently blot the slide dry with paper towels or bibulous paper or air dry. For delicate smears, such as certain body fluids, air drying is the best method. 6 Examine microscopically under an oil immersion lens at 1000x for phagocytes, bacteria, and other cellular material.

A

B • Figure 6-3  Gram stain procedures and principles. A, Gram-positive bacteria observed under oil immersion appear purple. B, Gram-negative bacteria observed under oil immersion appear pink. (Modified from Atlas RM: Principles of microbiology, St Louis, 2006, Mosby.)

outer lipid bilayer that is dehydrated during decolorization, accounts for the Gram staining differences between these two major groups of bacteria. Presumably, the extensive teichoic acid cross-links contribute to the ability of grampositive organisms to resist alcohol decolorization. Although the gram-positive organisms may take up the counterstain, their purple appearance will not be altered. Gram-positive organisms that have lost cell wall integrity because of antibiotic treatment, dead or dying cells, or the action of autolytic enzymes may allow the crystal violet to wash out with the decolorizing step and may appear gramvariable, with some cells staining pink and others staining purple. However, for identification purposes, these organisms are considered to be truly gram-positive. On the other hand, gram-negative bacteria rarely, if ever, retain crystal violet (i.e., appear purple) if the staining procedure has been properly performed. Host cells, such as red and white blood cells (phagocytes), allow the crystal violet stain to wash out with decolorization and should appear pink on smears that have been correctly prepared and stained.

Gram Stain Examination (Direct Smear)

Once stained, the smear is examined using the low power or 403 objective (4003 magnification). The microbiologist should scan the slide looking for white blood cells, epithelial cells, debris, and larger organisms such as fungi or parasites. Next the smear should be examined using the oil immersion or 1003 objective (10003 magnification) lens. When clinical material is Gram stained (e.g., the direct smear), the slide is evaluated for the presence of bacterial cells as well as the Gram reactions, morphologies (e.g., cocci or bacilli), and arrangements (e.g., chains, pairs, clusters) of the cells seen (Figure 6-4). This information often provides a preliminary diagnosis regarding the infectious agents and frequently is used to direct initial therapies for the patient. Direct smears should also be examined for the presence of inflammatory cells (e.g., phagocytes) that are key indicators of an infectious process. Noting the presence of other host cells, such as squamous epithelial cells in respiratory specimens, is also helpful, because the presence of these cells may indicate contamination with organisms and cells from the mouth (for more

CHAPTER 6  Role of Microscopy

77

Cocci

Staphylococci (clusters)

Streptococci (chains)

Diplococci (pairs)

Tetrads

Bacilli Diplobacilli

Coccobacilli

Streptobacilli

Miscellaneous

A

Fusiform bacilli

Spirochetes

• Figure 6-4  Examples

of common bacterial cellular morphologies, Gram staining reactions, and cellular arrangements.

information regarding the interpretation of respiratory smears, see Chapter 69. Observing background tissue debris and proteinaceous material, which generally stain gram-negative, also provides helpful information. For example, the presence of such material indicates that specimen material was adequately affixed to the slide. Therefore the absence of bacteria or inflammatory cells on such a smear is a true negative and not likely the result of loss of specimen during staining (Figure 6-5). Other ways that Gram stain evaluations of how direct smears are used are discussed throughout the chapters of Part VII that deal with infections of specific body sites. Several examples of Gram stains of direct smears are provided in Figure 6-6. Whatever is observed is also recorded and is used to produce a laboratory report for the physician. The report typically includes the following (Evolve Procedure 6-2): • The presence of host cells and debris. • The Gram reactions, morphologies (e.g., cocci, bacilli, coccobacilli), and arrangement of bacterial cells pre­ sent; prominent morphotypes indicating an infectious microorganism are important to note. It is also important to differentiate contaminating microorganisms or microbiota that would be confusing to the clinician and of little to no diagnostic value. Note: Reporting the absence of bacteria and host cells can be equally important. • Optionally, the relative amounts of bacterial cells (e.g., rare, few, moderate, many) may be provided. However, it is important to remember that to visualize bacterial

B

C • Figure 6-5  Gram stains of direct smears showing squamous cells and bacteria (A), proteinaceous debris (B), and proteinaceous debris with polymorphonuclear leukocytes and bacteria (C).

cells by light microscopy, a minimum concentration of 105 cells per 1 mL of specimen is required. This is a large number of bacteria for any normally sterile body site, and to describe the quantity as rare or few based on microscopic observation may be understating their significance in a clinical specimen. On the other hand, noting the relative amounts seen on direct smear may be useful laboratory information to correlate smear results with the amount of growth observed subsequently from cultures. • Direct correlation to the type of specimen; whether or not the specimen was collected from a sterile or nonsterile site, the presence of inflammatory cells, and the expected pathogens are critical to the microscopic evaluation of

78 PA RT I I  General Principles in Clinical Microbiology

A

B

C

D

E

F

G • Figure 6-6  Gram stain of direct smears showing polymorphonuclear leukocytes, proteinaceous debris,

and bacterial morphologies (arrows), including gram-positive cocci in chains (A), gram-positive cocci in pairs (B), gram-positive cocci in clusters (C), gram-negative coccobacilli (D), gram-negative bacilli (E), gram-negative diplococci (F), and mixed gram-positive and gram-negative morphologies (G).

CHAPTER 6  Role of Microscopy

Gram reactions. Gram stain evaluations are discussed throughout the chapters of Part VII that deal with infections of specific body sites. Although Gram stain evaluation of direct smears is routinely used to aid in the diagnosis of bacterial infections, unexpected but significant findings of other infectious etiologies may be detected and cannot be ignored. For example, fungal cells and elements generally stain gram-positive, but they may take up the crystal violet poorly and appear gram-variable (e.g., both pink and purple) or gram-negative. Because infectious agents besides bacteria may be detected by Gram stain, any unusual cells or structures observed on the smear should be evaluated further before being dismissed as unimportant (Figure 6-7). Gram Stain of Bacteria Grown in Culture (Indirect Smear)

The Gram stain also plays a key role in the identification of bacteria grown in culture. Similar to direct smears, indirect smears prepared from bacterial growth are evaluated for the bacterial cells’ Gram reactions, morphologies, and arrangements (Figure 6-4). If growth from more than one specimen is to be stained on the same slide, a wax pencil may be used to create divisions. The smear results will be used to determine subsequent testing for identifying and characterizing the organisms isolated from the patient specimen.

Acid-Fast Stains The acid-fast stain is the other commonly used stain for light-microscopic examination of bacteria. Principle

Similarly to the Gram stain, the acid-fast stain is specifically designed for a subset of bacteria whose cell walls contain long-chain fatty (mycolic) acids and is also considered a differential stain. Mycolic acids render the cells resistant to decolorization, even with acid alcohol decolorizers. Thus these bacteria are referred to as being acid-fast. Although these organisms may stain slightly or poorly as

79

gram-positive, the acid-fast stain takes full advantage of the waxy content of the cell walls to maximize detection. Mycobacteria are the most commonly encountered acid-fast bacteria, typified by Mycobacterium tuberculosis, the etiologic agent of tuberculosis. Bacteria lacking cell walls fortified with mycolic acids cannot resist decolorization with acid alcohol and are categorized as being non–acid-fast, a trait typical of most other clinically relevant bacteria. However, some degree of acid-fastness is a characteristic of a few nonmycobacterial bacteria, such as Nocardia spp., and coccidian parasites, such as Cryptosporidium spp. Procedure Overview

The classic acid-fast staining method, Ziehl-Neelsen, is depicted in Figure 6-8 and outlined in Evolve Procedure 6-3. The procedure requires heat to allow the primary stain (carbolfuchsin) to enter the wax-containing cell wall. A modification of this procedure, the Kinyoun acid-fast method (Evolve Procedure 6-4), does not require the use of heat or boiling water, minimizing safety concerns during the procedure. Because of a higher concentration of phenol in the primary stain solution, heat is not required for the intracellular penetration of carbolfuchsin. This modification is referred to as the “cold” method. When the acid-fast–stained smear is read with 10003 magnification, acid-fast–positive organisms stain red. Depending on the type of counterstain used (e.g., methylene blue or malachite green), other microorganisms, host cells, and debris stain a blue to blue-green color (Figures 6-8 and 6-9). As with the Gram stain, the acid-fast stain is used to detect acid-fast bacteria (e.g., mycobacteria) directly in clinical specimens and provide preliminary identification information for suspicious bacteria grown in culture. Because mycobacterial infections are much less common than infections caused by other non–acid-fast bacteria, the acid-fast stain is only performed on specimens from patients highly suspected of having a mycobacterial infection. That is, Gram staining is a routine part of most bacteriology procedures, whereas acid-fast staining is reserved for specific situations. Similarly, the acid-fast stain is applied to bacteria grown in culture when mycobacteria are suspected based on other growth characteristics (for more information regarding identification of mycobacteria, see Chapter 42). Because of the development of nucleic acid–based testing for the identification of organisms that are difficult to cultivate in the laboratory, such as acid-fast microorganisms, this technique is now rarely used in the clinical laboratory.

Phase-Contrast Microscopy

• Figure 6-7  Gram stains of direct smears can reveal infectious etiologies other than bacteria, such as the yeast Candida tropicalis.

Instead of using a stain to achieve the contrast necessary for observing microorganisms, altering microscopic techniques to enhance contrast offers another approach. Phase-contrast microscopy does not use a fixed smear preparation, but instead is used to view organisms and other cells in a wet preparation or wet mount. A wet mount preparation may consist

80 PA RT I I   General Principles in Clinical Microbiology

Steps for staining

Acid-fast–positive bacilli

1

Acid-fast–negative bacilli

Cells on slide

2 Stain red

3

Primary stain (carbolfuchsin red)

Stain red

Decolorizer (HCI, alcohol) Remain red

4

Become colorless Counterstain (methylene blue) Stain blue

Remain red

1 Fix smears on heated surface (60°C for at least 10 minutes). 2 Flood smears with carbolfuchsin (primary stain) and heat to almost boiling by performing the procedure on an electrically heated platform or by passing the flame of a Bunsen burner underneath the slides on a metal rack. The stain on the slides should steam. Allow slides to sit for 5 minutes after heating; do not allow them to dry out. Wash the slides in distilled water (note: tap water may contain acid-fast bacilli). Drain off excess liquid. 3 Flood slides with 3% HCI in 95% ethanol (decolorizer) for approximately 1 minute. Check to see that no more red color runs off the surface when the slide is tipped. Add a bit more decolorizer for very thick slides or those that continue to “bleed” red dye. Wash thoroughly with water and remove the excess. 4 Flood slides with methylene blue (counterstain) and allow to remain on surface of slides for 1 minute. Wash with distilled water and stand slides upright on paper towels to air dry. Do not blot dry. 5 Examine microscopically (see A and B below), screening at 400 magnification and confirm all suspicious (i.e., red) organisms at 1000 magnification using an oil-immersion lens.

A

B • Figure 6-8  The

Ziehl-Neelsen acid-fast stain procedures and principles. A, Acid-fast positive bacilli. B, Acid-fast negative bacilli. (Modified from Atlas RM: Principles of microbiology, St Louis, 2006, Mosby.)

B

A A

• Figure 6-9  Acid-fast stain of direct smear to show acid-fast bacilli staining deep red (arrow A) and non–acid-fast bacilli and host cells staining blue with the counterstain methylene blue (arrow B).

of a nonviscous liquid such as urine or a sample suspended in sterile saline, such as a vaginal sample. Phase-contrast microscopy uses beams of light passing through the specimen that are partially deflected by the different densities or thicknesses (i.e., refractive indices) of the microbial cells or cell structures

in the specimen. The greater the refractive index of an object, the more the beam of light is slowed, which results in decreased light intensity. These differences in light intensity translate into differences that provide contrast. Therefore phase microscopy translates differences in phases within the specimen into differences in light intensities that result in contrast among objects within the specimen being observed. Smear preparations and permanent staining is used to visualize cellular structures from nonliving or dead microorganisms. Because staining is not part of phase contrast microscopy, this method offers the advantage of allowing observation of viable microorganisms. The method is not commonly used in most aspects of diagnostic microbiology, but it is used to identify medically important fungi grown in culture (for more information regarding the use of phase contrast microscopy for fungal identification, see Chapter 58, and for parasitic identification, see Chapter 46).

Fluorescent Microscopy Principle of Fluorescent Microscopy Certain dyes, called fluorophores or fluorochromes, can be raised to a higher energy level after absorbing ultraviolet

CHAPTER 6  Role of Microscopy

81

Barrier filter

Fluorescent light

Light source

Excitation light

Exciter filter

Lightwave splitting mirror

Excitation light

Specimen (Contains microorganisms stained with fluorochrome)

• Figure 6-10  Principle of fluorescent microscopy. Microorganisms in a specimen are stained with a fluorescent dye. On exposure to excitation light, organisms are visually detected by the emission of fluorescent light by the dye with which they have been stained (i.e., fluorochroming) or “tagged” (i.e., immunofluorescence).

(excitation) light. When the dye molecules return to their normal, lower energy state, they release excess energy in the form of visible (fluorescent) light. This process is called fluorescence, and microscopic methods have been developed to exploit the enhanced contrast and detection that this phenomenon provides. Figure 6-10 diagrams the principle of fluorescent microscopy in which the excitation light is emitted from above (epifluorescence). An excitation filter passes light of the desired wavelength to excite the fluorochrome that has been used to stain the specimen. A barrier filter in the objective lens prevents the excitation wavelengths from damaging the eyes of the observer. When observed through the ocular lens, fluorescing objects appear brightly lit against a dark background. The color of the fluorescent light depends on the dye and light filters used. For example, use of the fluorescent dyes acridine orange, auramine, and fluorescein isothiocyanate (FITC) require blue excitation light, exciter filters that select for light in the 450- to 490-l wavelength range, and a barrier filter for 515-l. Calcofluor white, on the other hand, requires violet excitation light, an exciter filter that selects for light in the 355- to 425-l wavelength range and a barrier filter for 460-l. Which dye is used often depends on which organism is suspected and the fluorescent method used. The intensity of the contrast obtained with fluorescent microscopy is an advantage it has over the use of chromogenic dyes (e.g., the crystal violet and safranin of the Gram

stain) and light microscopy. The disadvantage of fluorescent microscopy results from photobleaching or quenching of the fluorophore over a period of time. Photobleaching or fading is the permanent loss of fluorescence as a result of chemical damage to the fluorochrome. Quenching is a result of the transfer of the light energy to nearby molecules in the sample such as free radicals, salts of heavy metals, or halogens. Quenching may be alleviated by adding chemical scavengers to the mounting fluid. Storing fluorescent slides in a dark container and refrigerated at 2° to 8°C will also decrease the loss of fluorescence over time. Digital photography is frequently used to maintain permanent records for fluorescent microscopy.

Staining Techniques for Fluorescent Microscopy Based on the composition of the fluorescent stain reagents, fluorescent staining techniques may be divided into two general categories: fluorochroming, in which a fluorescent dye or fluorophore is used alone, and immunofluorescence, in which fluorescent dyes have been linked (conjugated) to specific antibodies. The principal differences between these two methods are outlined in Figure 6-11.

Fluorochroming In fluorochroming a direct chemical interaction occurs between the fluorescent dye or fluorophore and a component

82 PA RT I I   General Principles in Clinical Microbiology

Dye

Target bacteria to be stained

Staining results

+

A Fluorochroming Fluorescent dye

All bacteria stain and fluoresce

Fluorescent dye

B Immunofluorescence

Conjugate

Antigens

Specific fluorescence

+

Specific antibody

• Figure 6-11  Principles

of fluorochroming and immunofluorescence. Fluorochroming (A) involves nonspecific staining of any bacterial cell with a fluorescent dye. Immunofluorescence (B) uses antibodies labeled with fluorescent dye (i.e., a conjugate) to specifically stain a particular bacterial species.

of the bacterial cell; this interaction is the same as occurs with the stains used in light microscopy. The difference is that use of a fluorescent dye enhances contrast and amplifies the observer’s ability to detect stained cells tenfold greater than would be observed by light microscopy. For example, a minimum concentration of at least 105 organisms per milliliter of specimen is required for visualization by light microscopy, whereas by fluorescent microscopy that number decreases to 104 per milliliter. The most common fluorochroming methods used in diagnostic microbiology include acridine orange, auramine-rhodamine, and calcofluor white. Acridine Orange

The fluorochrome acridine orange binds to nucleic acid. This staining method (Evolve Procedure 6-4) can be used to confirm the presence of bacteria in blood cultures when Gram stain results are difficult to interpret or when the presence of bacteria is highly suspected but none are detected using light microscopy. Because acridine orange stains all nucleic acids, it is nonspecific. Therefore all microorganisms and nucleic acid–containing host cells will stain and give a bright orange fluorescence. Although this stain can be used to enhance detection, it does not discriminate between gram-negative and gram-positive bacteria. The stain is also used for detection of cell wall–deficient bacteria (e.g., mycoplasmas) grown in culture that are incapable of retaining the dyes used in the Gram stain (Figure 6-12; Evolve Procedure 6-5). Auramine-Rhodamine

The waxy mycolic acids in the cell walls of mycobacteria have an affinity for the fluorochromes auramine and rhodamine. As shown in Figure 6-13, these dyes will nonspecifically bind to nearly all mycobacteria. The mycobacterial cells appear bright yellow or orange against a greenish background. This fluorochroming method can be used to enhance detection of mycobacteria directly in

patient specimens and for initial characterization of cells grown in culture. Calcofluor White

The cell walls of fungi will bind the stain calcofluor white, which greatly enhances fungal visibility in tissue and other specimens. This fluorochrome is commonly used to directly detect fungi in clinical material and to observe subtle characteristics of fungi grown in culture (for more information regarding the use of calcofluor white for the laboratory diagnosis of fungal infections, see Chapter 58). Calcofluor white may also be used to visualize some parasites such as microsporidia.

Immunofluorescence As discussed in Chapter 3, antibodies are molecules that have high specificity for interacting with microbial antigens. That is, antibodies specific for an antigen characteristic of a particular microbial species will only combine with that antigen. Therefore if antibodies are conjugated (chemically linked) to a fluorescent dye, the resulting dye-antibody conjugate can be used to detect, or “tag,” specific microbial agents (Figure 6-11). When “tagged,” the microorganisms become readily detectable by fluorescent microscopy. Thus immunofluorescence combines the amplified contrast provided by fluorescence with the specificity of antibodyantigen binding. This method is used to directly examine patient specimens for bacteria that are difficult or slow to grow (e.g., Legionella spp., Bordetella pertussis, and Chlamydia trachomatis) or to identify organisms already grown in culture. FITC, which emits an intense, apple green fluorescence, is the fluorochrome most commonly used for conjugation to antibodies (Figure 6-14). Immunofluorescence is also used in virology (Chapter 64) and to some extent in parasitology (Chapter 46).

CHAPTER 6  Role of Microscopy

A

B

C

D

83

• Figure 6-12  Comparison of acridine orange fluorochroming and Gram stain. Gram stain of mycoplasma

demonstrates the inability to distinguish cell wall–deficient organisms from amorphous gram-negative debris (A). Staining the same specimen with acridine orange confirms the presence of nucleic acid–containing organisms (B). Gram stain distinguishes between gram-positive and gram-negative bacteria (C), but all bacteria stain the same with the nonspecific acridine orange dye (D).

A

B • Figure 6-13  Comparison

of the Ziehl-Neelsen–stained (A) and auramine-rhodamine–stained (B) Mycobacterium spp. (arrows).

Fluorescent in situ hybridization using peptide nucleic acid probes is a powerful technique used in the clinical laboratory and is discussed in further detail in Chapter 8. Two additional types of microscopy, dark-field microscopy and electron microscopy, are not commonly used to diagnose infectious diseases. However, because of their importance in the detection and characterization of certain microorganisms, they are discussed here.

Dark-Field Microscopy Dark-field microscopy is similar to phase-contrast microscopy in that it involves the alteration of microscopic technique rather than the use of dyes or stains to achieve contrast. By the dark-field method, the condenser does not allow light to pass directly through the specimen but directs the light to hit the specimen at an oblique angle (Figure 6-15, A). Only light that

84 PA RT I I   General Principles in Clinical Microbiology

A

B • Figure 6-14  Immunofluorescence stains of Legionella spp. (A) and Bordetella pertussis (B) used for identification.

Light that strikes specimen

Objective lens

Specimen

Condenser lens

Light

A

Dark-field ring

B

• Figure 6-15  Dark-field

microscopy. Principal (A) and dark-field photomicrograph showing the tightly coiled characteristics of the spirochete Treponema pallidum (B). (From Atlas RM: Principles of microbiology, St Louis, 2006, Mosby.)

hits objects, such as microorganisms in the specimen, will be deflected upward into the objective lens for visualization. All other light that passes through the specimen will miss the objective, thus making the background a dark field. This method has greatest utility for detecting certain bacteria directly in patient specimens that, because of their thin dimensions, cannot be seen by light microscopy and, because of their physiology, are difficult to grow in culture. Dark-field microscopy is used to detect spirochetes, the most notorious of which is the bacterium Treponema pallidum, the causative agent of syphilis (for more information regarding spirochetes, see Chapter 45). As shown in Figure 6-15, B, spirochetes viewed using dark-field microscopy will appear extremely bright against a black field. The use of dark-field microscopy in diagnostic microbiology has decreased with the advent of reliable serologic techniques for the diagnosis of syphilis.

Electron Microscopy The electron microscope uses electrons instead of light to visualize small objects and, instead of lenses, the electrons

are focused by electromagnetic fields and form an image on a fluorescent screen, like a television screen. Because of the substantially increased resolution this technology allows, magnifications in excess of 100,000,0003, compared with the 10003 magnification provided by light microscopy, are achieved. Electron microscopes are of two general types: the transmission electron microscope (TEM) and the scanning electron microscope (SEM). TEM passes the electron beam through objects and allows visualization of internal structures. SEM uses electron beams to scan the surface of objects and provides three-dimensional views of surface structures (Figure 6-16). These microscopes are powerful research tools, and many new morphologic features of bacteria, bacterial components, fungi, viruses, and parasites have been discovered using electron microscopy. However, because an electron microscope is a major capital investment and is not needed for the laboratory diagnosis of most infectious diseases (except for certain viruses and microsporidian parasites), few laboratories employ this method.

CHAPTER 6  Role of Microscopy

85

Digital Automated Microscopy

A

Automation in digital microscopy using sophisticated software and unique technology now permits laboratories to acquire microscopic digital images of Gram stains using a web-based interface. This interface allows images using a fully automated microscope to be viewed on a single screen (COPAN, Murieta, CA, and MetaSystems GmbH, Boston, MA). Digital imaging, including scanning entire slides, provides an opportunity for standardization, cost reductions, and quality improvement. Digital or virtual microscopy can greatly aid departments, college programs, and professional organizations in the delivery of quality cost-effective microscopy training. An additional tool that now allows whole slide imaging is available that allows the viewer to track the slide on the x and y axis, very much like using a standard microscope. A number of technologies, including Leica and PathXL, currently provide mobile device viewers for virtual microscopy.

  Visit the Evolve site for a complete list of procedures, review questions, and case study answers.

Bibliography B • Figure 6-16  A, Transmission electron micrograph showing Esche-

richia coli cells internalized by a human mast cell (arrows). B, Scanning electron micrograph of E. coli interacting with the surface of a human mast cell (arrows). (A and B Courtesy SN Abraham, Washington University School of Medicine, St Louis.)

Atlas RM: Principles of microbiology, St Louis, 2006, Mosby. Hamilton PW, Wang Y, McCullough SJ: Virtual microscopy and digital pathology in training and education, APMIS 120:305-315, 2012. Jorgensen J, Pfaller M, Carroll K, et al: Manual of clinical microbiology, ed 11, Washington, DC, 2015, ASM Press. Lenhoff A: Digital imaging: transformative new technology, Med Lab Obs 47:32, 2015. Stokes BO: Principles of cytocentrifugation, Lab Med 7, 2004.

7

Traditional Cultivation and Identification OBJECTIVES 1. Define bacterial cultivation and list the three most important purposes for bacterial cultivation. 2. Define bacterial media; list the four general types of media and explain the general biochemical principle for each type. 3. List the environmental conditions that are crucial in supporting bacterial in vitro growth and explain how each factor is controlled and monitored. 4. Explain the most common bacterial streaking technique, the principle associated with the technique, and how colonies are enumerated using this technique. 5. Identify the key criteria used in characterizing and reporting bacterial culture growth pertaining to the phenotypic results; differentiate genotypic and phenotypic characteristics. 6. Describe the importance of using colony morphology, Gram staining, and site of infection to identify a potential pathogenic microorganism. 7. Explain the use and chemical principle of the following enzymatic tests used in preliminary bacterial identification: catalase test, oxidase test, urease test, indole test, PYR test, and hippurate hydrolysis. 8. Define and differentiate bacterial susceptibility and resistance; give an example of how these are used to assist in the identification of bacteria. 9. List the three assays used to measure metabolic pathways and provide an example of each. 10. Describe the steps required to develop “rapid” identification schemes and explain how these differ from conventional schemes. 11. List the four basic identification components common to all commercially available multitest systems.

D

irect laboratory methods such as microscopy provide preliminary information about the bacteria involved in an infection, but bacterial growth is usually required for definitive identification and characterization. This chapter presents the various principles and methods required for bacterial cultivation and identification.

Organism Identification As previously described in Chapter 6, a Direct gram stain provides the clinician with preliminary information regarding 86

the likely presence or absence of a pathogen based on the cellular morphology, quantitation, and cellular arrangement of the organisms observed. In addition, information regarding the presence, type, and quantity of inflammatory cells or other cellular material may alert the clinician to the source or etiologic agent of the infection if the organism cannot be visualized. After the laboratorian reviews the preliminary information provided by a direct gram stain, the specimen or patient sample is then processed for identification by either a phenotypic method as described in this chapter, genotypic method (nucleic acid–based) (Chapter 8), and/or an immunologic method (Chapter 9).

Principles of Bacterial Cultivation This section focuses on the principles and practices of bacterial cultivation, which has three main purposes: • To grow and isolate all bacteria present in a clinical specimen • To determine which of the bacteria that grow are most likely causing infection and which are likely contaminants or colonizers (normal microbiota) • To obtain sufficient growth of clinically relevant bacteria to allow identification, characterization, and susceptibility testing Cultivation is the process of growing microorganisms in culture by taking bacteria from the infection site (i.e., the in vivo environment) by some means of specimen collection and growing them in the artificial environment of the laboratory (i.e., the in vitro environment). Once grown in culture, most bacterial populations are easily observed without microscopy and are present in sufficient quantities to allow laboratory identification procedures to be performed. The successful transition from the in vivo to the in vitro environment requires that the nutritional and environmental growth requirements of bacterial pathogens be met. The environmental transition is not necessarily easy for bacteria. In vivo they are utilizing various complex metabolic and physiologic pathways developed for survival on or within the human host. Then, relatively suddenly, they are exposed to the artificial in vitro environment of the laboratory. The bacteria must adjust to survive and multiply. Of importance,

CHAPTER 7  Traditional Cultivation and Identification

Phases of Growth Media

their survival depends on the availability of essential nutrients and appropriate environmental conditions. Although growth conditions can be met for most known bacterial pathogens, the needs of certain clinically relevant bacteria are not sufficiently understood to allow for development of in vitro laboratory growth conditions. Examples include Treponema pallidum (the causative agent of syphilis) and Mycobacterium leprae (the causative agent of leprosy). Additional identification systems such as immunologic or genotypic methods must be used to identify these organisms in a clinical specimen. If an organism is not identifiable through alternate methods, the clinician must rely on the patient signs and symptoms to determine the likely cause of the patient’s illness and an appropriate treatment option.

Growth media are used in either of two phases: broth (liquid) or agar (solid). In some instances (e.g., certain blood culture methods), a biphasic medium that contains both a liquid and a solid phase may be used. In broth media, nutrients are dissolved in water, and bacterial growth is indicated by a change in the broth’s appearance from clear to turbid (i.e., cloudy). The turbidity, or cloudiness, of the broth results from light deflected by bacteria present in the culture (Figure 7-1). More growth indicates a higher cell density and greater turbidity. At least 106 bacteria per milliliter of broth are needed for turbidity to be detected with the unaided eye. Some broths may also contain a pH indicator, such as phenol red, that may change color in the presence of bacterial metabolites rather than relying solely on the growth of the organism. In addition to amount of growth present, the location of growth within the broth, such as the thioglycollate broth, which contains a small amount of agar (making it a semisolid medium), provides an indication of the type of organism present based on oxygen requirements. Strict anaerobes will grow at the bottom of the broth tube, whereas aerobes will grow near the surface. Microaerophilic organisms will grow slightly below the surface where oxygen concentrations are lower than atmospheric concentrations. In addition, facultative anaerobes and aerotolerant organisms will grow throughout the medium, because they are unaffected by the variation in oxygen content. A solid medium is a combination of a solidifying agent added to the nutrients and water. Agarose, the most common solidifying agent, has the unique property of melting at high temperatures (95°C) but resolidifying after the temperature falls below 50°C. The addition of agar allows a solid medium to be prepared by heating to an extremely high temperature, which is required for sterilization, and cooling to 55°C to 60°C for distribution into petri dishes. On further cooling, the agarose-containing medium forms a stable solid gel referred to as agar. The petri dish containing the agar is referred to as the agar plate. Different agar media usually are identified according to the major nutritive components of the medium (e.g., sheep

Nutritional Requirements As discussed in Chapter 2, bacteria have numerous nutritional needs that include different gases, water, various ions, nitrogen, sources for carbon, and energy. The source for carbon and energy is commonly supplied in carbohydrates (e.g., sugars and their derivatives) and proteins.

General Concepts of Culture Media In the laboratory, nutrients are incorporated into culture media on or in which bacteria are grown. If a culture medium meets a bacterial cell’s growth requirements, then that cell will multiply to sufficient numbers to allow visualization by the unaided eye. Of course, bacterial growth after inoculation also requires that the medium be placed in optimal environmental conditions. Because different pathogenic bacteria have different nutritional needs, various types of culture media have been developed for use in diagnostic microbiology. For certain bacteria, the needs are relatively complex, and exceptional media components must be used for growth. Bacteria with such requirements are said to be fastidious. Alternatively, the nutritional needs of most clinically important bacteria are relatively basic and straightforward. These bacteria are considered nonfastidious.

A

B • Figure 7-1  A,

87

Clear broth indicating no bacterial growth (left), and turbid broth indicating bacterial growth (right). B, Individual bacterial colonies growing on the agar surface after incubation.

88 PA RT I I  General Principles in Clinical Microbiology

blood agar, bile esculin agar, xylose-lysine-deoxycholate agar). With appropriate incubation conditions, each bacterial cell inoculated onto the agar medium surface will proliferate to sufficiently large numbers to be observable with the unaided eye (Figure 7-1). The resulting bacterial population is considered to be derived from a single bacterial cell and is known as a pure colony. In other words, all bacterial cells within a single colony are the same genus and species, having identical genetic and phenotypic characteristics (i.e., are derived from a single clone). Pure cultures are required for subsequent procedures used to identify and characterize bacteria. The ability to select pure (individual) colonies is one of the first and most important steps required for bacterial identification and characterization.

Media Classifications and Functions Media are categorized according to their function and use. In diagnostic bacteriology there are four general categories of media: enrichment, nutritive, selective, and differential. Enrichment media contain specific nutrients required for the growth of particular bacterial pathogens that may be present alone or with other bacterial species in a patient specimen. This media type is used to enhance the growth of a particular bacterial pathogen from a mixture of organisms by providing specific nutrients for the organism’s growth. One example of such a medium is buffered charcoal–yeast extract agar (BCYE), which provides l-cysteine and other nutrients required for the growth of Legionella pneumophila, the causative agent of legionnaires’ disease (Figure 7-2). Enrichment media also includes specialized enrichment broths used to enhance the growth of organisms present in low numbers. Broths may be used to ensure growth of an organism when no organisms grow on solid media after initial specimen inoculation. Enrichment broths used in the clinical laboratory often include thioglycollate for the isolation of anaerobes, LIM (Todd Hewitt broth containing colistin and nalidixic acid) broth for selective

enrichment of group B streptococci, and gram-negative (GN) broth for the selective enrichment of enteric gramnegative organisms. Nutritive media contain nutrients that support growth of most nonfastidious organisms without giving any particular organism a growth advantage. Nutrient media include tryptic soy agar and nutrient agar plates for bacteria, or Sabouraud’s dextrose agar for fungi. Selective media contain one or more agents that are inhibitory to all organisms except those “selected” by the specific growth condition or chemical. In other words, these media select for the growth of certain bacteria to the disadvantage of others. Inhibitory agents used for this purpose include dyes, bile salts, alcohols, acids, and antibiotics. An example of a selective medium is phenylethyl alcohol (PEA) agar with 5% sheep blood, which inhibits the growth of aerobic and facultatively anaerobic gram-negative rods and allows grampositive cocci to grow (Figure 7-3). Selective and inhibitory chemicals included within nutritive media prevent the overgrowth of normal microbiota or contaminating organisms that would prevent the identification of pathogenic organisms. However, the use of selective media does not ensure that the inhibited organisms are not present in small quantity and may simply be too small to see. In addition,

A

B

A

B

• Figure 7-2  Growth

of Legionella pneumophila on the enrichment medium buffered charcoal–yeast extract (BCYE) agar, used specifically to grow this bacterial genus.

• Figure 7-3  A, Heavy mixed growth of the gram-negative bacillus Escherichia coli (arrow A) and the gram-positive coccus Enterococcus spp. (arrow B) on the nonselective medium sheep blood agar (SBA). B, The selective medium SBA containing phenylethyl-alcohol (PEA) with 5% sheep blood only allows the enterococci to grow (arrow).

CHAPTER 7  Traditional Cultivation and Identification

89

C

D B A

A

B

• Figure 7-4  Differential capabilities of MacConkey agar as gramnegative bacilli capable of fermenting lactose appear deep purple (arrow A), whereas those not able to ferment lactose appear light pink or relatively colorless (arrow B).

• Figure 7-5  Different colony morphologies exhibited on sheep blood

prolonged incubation of selective media may result in dehydration or evaporation of the selective agent, permitting contaminating organisms to grow. Differential media employ some factor (or factors) that allow colonies of one bacterial species or type to exhibit certain metabolic or culture characteristics that can be used to distinguish them from other bacteria growing on the same agar plate. One commonly used differential medium is MacConkey agar, which differentiates between gram-negative bacteria that can and cannot ferment the sugar lactose (Figure 7-4). Of importance, many media used in diagnostic bacteriology provide more than one function. For example, MacConkey agar is both differential and selective, or combination media, because the media will not allow most gram-positive bacteria to grow; it is differential based on fermentation of lactose as previously described. Another example is sheep blood agar. This is the most commonly used nutritive medium for diagnostic bacteriology, because it allows many organisms to grow. However, in many ways this agar is also differential, because the appearance of colonies produced by certain bacterial species is readily distinguishable, as indicated in Figure 5-2. Figure 7-5 shows differential hemolytic patterns of various organisms.

specimens. Similarly, other chapters throughout Part III discuss media used to identify and characterize specific organisms.

Summary of Artificial Media for Routine Bacteriology Various broth and agar media that have enrichment, selective, or differential capabilities and are used frequently for routine bacteriology are listed alphabetically in Table 7-1. Anaerobic bacteriology (Part III, Section 13), mycobacteriology (Part III, Section 14), and mycology (Chapter 58) use similar media strategies; details regarding these media are provided in the appropriate chapters. Of the dozens of available media, only those most commonly used for routine diagnostic bacteriology are summarized in this discussion. Part VII discusses which media should be used to culture bacteria from various clinical

agar by various bacteria, including alpha-hemolytic streptococci (arrow A), gram-negative bacilli (arrow B), beta-hemolytic streptococci (arrow C), and Staphylococcus aureus (arrow D).

Brain-Heart Infusion

Brain-heart infusion (BHI) is a nutritionally rich medium used to grow various microorganisms, either as a broth or as an agar, with or without added blood. Key ingredients include infusion from several animal tissue sources, added peptone (protein), phosphate buffer, and a small concentration of dextrose. The carbohydrate provides a readily accessible source of energy for many bacteria. BHI broth is often used as a major component of the media developed for culturing a patient’s blood for bacteria (see Chapter 67), for establishing bacterial identification, and for certain tests to determine bacterial susceptibility to antimicrobial agents (see Chapter 10). Chocolate Agar

Chocolate agar is essentially the same as blood agar except that during preparation the red blood cells are lysed when added to molten agar base. The cell lysis provides for the release of intracellular nutrients such as hemoglobin, hemin (“X” factor), and the coenzyme nicotinamide adenine dinucleotide (NAD, or “V” factor) into the agar for utilization by fastidious bacteria. Red blood cell lysis gives the medium the chocolate-brown color from which the agar gets its name. The most common bacterial pathogens that require this enriched medium for growth include Neisseria gonorrhoeae, the causative agent of gonorrhea, and Haemophilus spp., which cause infections usually involving the respiratory tract and middle ear. Neither of these organisms is able to grow on sheep blood agar. Columbia CNA with Blood

Columbia agar base is a nutritionally rich formula containing three peptone sources and 5% defibrinated (whole blood with fibrin removed to prevent clotting) sheep blood. This supportive medium can also be used to help differentiate

90 PA RT I I  General Principles in Clinical Microbiology

TABLE Plating Media for Routine Bacteriology 7-1

Medium

Components/Comments

Primary Purpose

Bile esculin agar (BEA)

Nutrient agar base with ferric citrate. Hydrolysis of esculin by group D streptococci imparts a brown color to medium; sodium deoxycholate inhibits many bacteria.

Differential isolation and presumptive identification of group D streptococci and enterococci

Bile esculin azide agar with vancomycin

Contains azide to inhibit gram-negative bacteria, vancomycin to select for resistant gram-positive bacteria, and bile esculin to differentiate enterococci from other vancomycin-resistant bacteria that may grow

Selective and differential for cultivation of vancomycin-resistant enterococci from clinical and surveillance specimens

Blood agar (BA)

Trypticase soy agar, Brucella agar, or beef heart infusion with 5% sheep blood

Cultivation of nonfastidious microorganisms, determination of hemolytic reactions

Bordet-Gengou agar

Potato-glycerol–based medium enriched with 15%20% defibrinated blood; contaminants inhibited by methicillin (final concentration of 2.5 µm/mL)

Isolation of Bordetella pertussis and Bordetella parapertussis

Brain-heart infusion agar or broth

Dextrose, pork brain, and heart dehydrated infusions

Cultivation of fastidious organisms

Buffered charcoal–yeast extract agar (BCYE)

Yeast extract, agar, charcoal, and salts supplemented with L-cysteine HCl, ferric pyrophosphate, ACES buffer, and alpha-ketoglutarate

Enrichment for Legionella spp. Supports the growth of Francisella and Nocardia spp.

Buffered charcoal–yeast extract (BCYE) agar with antibiotics

BCYE supplemented with polymyxin B, vancomycin, and ansamycin to inhibit gram-negative bacteria, gram-positive bacteria, and yeast, respectively

Enrichment and selection for Legionella spp.

Burkholderia cepacia selective agar

Bile salts, gentamicin, ticarcillin, polymyxin B, peptone, yeast extract

For recovery of B. cepacia from cystic fibrosis patients

Campy-blood agar

Contains vancomycin (10 mg/L), trimethoprim (5 mg/L), polymyxin B (2500 U/L), amphotericin B (2 mg/L), and cephalothin (15 mg/L) in a Brucella agar base with sheep blood

Selective for Campylobacter spp.

Campylobacter thioglycollate broth

Thioglycollate broth supplemented with increased agar concentration and antibiotics

Selective holding medium for recovery of Campylobacter spp. Incubated at 4°C for cold-enrichment

CDC* anaerobe 5% sheep blood agar

Tryptic soy broth with phenyl-ethyl alcohol, 5% sheep blood, and added nutrients

Improved growth of obligate, slowgrowing anaerobes

Cefoperazone, vancomycin, amphotericin (CVA) medium

Blood-supplemented enrichment medium containing cefoperazone, vancomycin, and amphotericin to inhibit growth of most gram-negative bacteria, gram-positive bacteria, and yeast, respectively

Selective medium for isolation of Campylobacter spp.

Cefsulodin-irgasannovobiocin (CIN) agar

Peptone base with yeast extract, mannitol, and bile salts; supplemented with cefsulodin, irgasan, and novobiocin; neutral red and crystal violet indicators

Selective for Yersinia spp.; may be useful for isolation of Aeromonas spp.

Chocolate agar

Peptone base, enriched with solution of 2% hemoglobin or IsoVitaleX (BD BBLTM Becton Dickenson, Sparks MD)

Cultivation of fastidious microorganisms such as Haemophilus spp., Brucella spp. and pathogenic Neisseria spp.

Chromogenic media

Organism-specific nutrient base, selective supplements, and chromogenic substrate

Designed to optimize growth and differentiate a specific type of organism; routinely used in the identification of yeasts, methicillin-resistant Staphylococcus aureus (MRSA), and a variety of other organisms

*Media was originally formulated by the Centers for Disease Control or CDC.

CHAPTER 7  Traditional Cultivation and Identification

91

TABLE Plating Media for Routine Bacteriology—cont'd 7-1

Medium

Components/Comments

Primary Purpose

Columbia colistinnalidixic acid (CNA) agar

Columbia agar base with 10 mg colistin per liter, 15 mg nalidixic acid per liter, and 5% sheep blood

Selective isolation of gram-positive cocci

Cystine-tellurite blood agar

Infusion agar base with 5% sheep blood; reduction of potassium tellurite by Corynebacterium diphtheriae produces black colonies

Isolation of Corynebacterium diphtheriae

Eosin methylene blue (EMB) agar (Levine)

Peptone base containing lactose; eosin Y and methylene blue as indicators

Isolation and differentiation of lactosefermenting and non–lactosefermenting enteric bacilli

Gram-negative broth (GN)

Peptone-base broth with glucose and mannitol; sodium citrate and sodium deoxycholate act as inhibitory agents

Selective (enrichment) liquid medium for enteric pathogens

Hektoen enteric (HE) agar

Peptone-base agar with bile salts, lactose, sucrose, salicin, and ferric ammonium citrate; indicators include bromthymol blue and acid fuchsin

Differential, selective medium for the isolation and differentiation of Salmonella and Shigella spp. from other gram-negative enteric bacilli

Loeffler medium

Animal tissue (heart muscle), dextrose, egg-and-beef serum, and sodium chloride

Isolation and growth of Corynebacterium spp.

MacConkey agar

Peptone base with lactose; gram-positive organisms inhibited by crystal violet and bile salts; neutral red as indicator

Isolation and differentiation of lactose fermenting and non–lactosefermenting enteric bacilli

MacConkey sorbitol agar

A modification of MacConkey agar in which lactose has been replaced with D-sorbitol as the primary carbohydrate

For the selection and differentiation of E. coli O157:H7 in stool specimens

Mannitol salt agar

Peptone base, mannitol, and phenol red indicator; salt concentration of 7.5% inhibits most bacteria

Selective differentiation of staphylococci

New York City (NYC) agar

Peptone agar base with cornstarch, supplemented with yeast dialysate, 3% hemoglobin, and horse plasma; antibiotic supplement includes vancomycin (2 µg/mL), colistin (5.5 µg/mL), amphotericin B (1.2 µg/mL), and trimethoprim (3 µg/mL)

Selective for Neisseria gonorrhoeae; also supports the growth of Ureaplasma urealyticum and some Mycoplasma spp.

Phenylethyl alcohol (PEA) agar

Nutrient agar base; phenylethyl alcohol inhibits growth of gram-negative organisms

Selective isolation of aerobic grampositive cocci and bacilli and anaerobic gram-positive cocci and gram-negative bacilli

Regan Lowe

Charcoal agar supplemented with horse blood, cephalexin, and amphotericin B

Enrichment and selective medium for isolation of Bordetella pertussis

Salmonella-Shigella (SS) agar

Peptone base with lactose, ferric citrate, and sodium citrate; neutral red as indicator; inhibition of coliforms by brilliant green and bile salts

Selective for Salmonella and some Shigella spp.

Schaedler agar

Peptone and soy protein base agar with yeast extract, dextrose, and buffers; addition of hemin, L-cysteine, and 5% blood enriches for anaerobes

Nonselective medium for the recovery of anaerobes and aerobes Selective for Campylobacter spp. and Helicobacter spp.

Selenite broth

Peptone-base broth; sodium selenite toxic for most Enterobacteriaceae

Enrichment of isolation of Salmonella spp.

Skirrow agar

Peptone and soy protein–base agar with lysed horse blood; vancomycin inhibits gram-positive organisms; polymyxin B and trimethoprim inhibit most gram-negative organisms

Selective for Campylobacter spp.

Streptococcal selective agar (SSA)

Contains crystal violet, colistin, and trimethoprimsulfamethoxazole in 5% sheep blood agar base

Selective for Streptococcus pyogenes and Streptococcus agalactiae Continued

92 PA RT I I  General Principles in Clinical Microbiology

TABLE Plating Media for Routine Bacteriology—cont'd 7-1

Medium

Components/Comments

Primary Purpose

Tetrathionate broth

Peptone-base broth; iodine and potassium iodide, bile salts, and sodium thiosulfate inhibit grampositive organisms and Enterobacteriaceae

Selective for Salmonella and Shigella spp., except Salmonella enterica Typhi

Thayer-Martin agar (TM) (modified Thayer Martin [MTM])

Blood agar base enriched with hemoglobin and supplement B; contaminating organisms inhibited by colistin, nystatin, vancomycin, and trimethoprim

Selective for N. gonorrhoeae and N. meningitidis. Supports the growth of Francisella and Brucella spp.

Thioglycollate broth

Pancreatic digest of casein, soy broth, and glucose enrich growth of most microorganisms; includes reducing agents thioglycollate, cystine, and sodium sulfite; semisolid medium with a low concentration of agar reducing oxygen diffusion in the medium

Supports growth of anaerobes, aerobes, microaerophilic, and fastidious microorganisms

Thiosulfate citrate–bile salts (TCBS) agar

Peptone base agar with yeast extract, bile salts, citrate, sucrose, ferric citrate, and sodium thiosulfate; bromthymol blue acts as indicator

Selective and differential for Vibrio spp.

Todd-Hewitt broth supplemented with antibiotics (LIM)

Supplemented with nalidixic acid and gentamicin or colistin for greater selectivity; thioglycollate and agar reduce redox potential

Selection and enrichment for Streptococcus agalactiae in female genital specimens

Trypticase soy broth (TSB)

All-purpose enrichment broth that can support the growth of many fastidious and nonfastidious bacteria

Enrichment broth used for subculturing various bacteria from primary agar plates

Xylose lysine deoxycholate (XLD) agar

Yeast extract agar with lysine, xylose, lactose, sucrose, and ferric ammonium citrate; sodium deoxycholate inhibits gram-positive organisms; phenol red as indicator

Isolation and differentiation of Salmonella and Shigella spp. from other gramnegative enteric bacilli

bacterial colonies based on the hemolytic reactions they produce. CNA refers to the antibiotics colistin (C) and nalidixic acid (NA) that are added to the medium to suppress the growth of most gram-negative organisms while allowing gram-positive bacteria to grow, thus conferring a selective property to this medium. Colistin disrupts the cell membranes of gram-negative organisms, and nalidixic aid blocks DNA replication in susceptible organisms. Gram-Negative Broth

A selective broth, gram-negative (GN) broth is used for the cultivation of gastrointestinal pathogens (i.e., Salmonella spp. and Shigella spp.) from stool specimens and rectal swabs. The broth contains several active ingredients, including sodium citrate and sodium deoxycholate (a bile salt) that inhibit gram-positive organisms and the early multiplication of gram-negative, nonenteric pathogens. The broth also contains mannitol as the primary carbon source. Mannitol is the favored energy source for many enteric pathogens, but it is not utilized by many other nonpathogenic enteric organisms. To optimize its selective nature, GN broth should be subcultured 6 to 8 hours after initial inoculation and incubation. After this time, the nonenteric pathogens begin to overgrow the pathogens that may be present in very low numbers.

Hektoen Enteric Agar

Hektoen enteric (HE) agar contains bile salts and dyes (bromthymol blue and acid fuchsin) to selectively slow the growth of most nonpathogenic gram-negative bacilli found in the gastrointestinal tract and allow Salmonella spp. and Shigella spp. to grow. The medium is also differential, because many nonenteric pathogens that do grow will appear as orange to salmon-colored colonies. This colonial appearance results from the organism’s ability to ferment the lactose, sucrose or salicin in the medium, resulting in the production of acid, which lowers the medium’s pH and causes a color change in the pH indicator bromthymol blue. Salmonella spp. and Shigella spp. do not ferment these carbon compounds, so no color change occurs and their colonies maintain the original blue-green color of the medium. As an additional differential characteristic, the medium contains ferric ammonium citrate, an indicator for the detection of H2S, so that H2S-producing organisms, such as Salmonella spp., can be visualized as colonies exhibiting a black precipitate (Figure 7-6). MacConkey Agar

MacConkey agar is the most frequently used primary selective and differential agar. This medium contains crystal violet dye to inhibit the growth of gram-positive bacteria and fungi and allows many types of gram-negative bacilli to grow. The pH indicator, neutral red, provides this medium

CHAPTER 7  Traditional Cultivation and Identification

A

B

• Figure 7-6  Differential capabilities of Hektoen enteric (HE) agar for

lactose-fermenting, gram-negative bacilli (e.g., Escherichia coli, arrow A) and H2S producers (e.g., Salmonella spp., arrow B).

with a differential capacity. Bacterial fermentation of lactose results in acid production, which decreases the pH of the medium and causes the neutral red indicator to give bacterial colonies a pink to red color. Non–lactose-fermenters, such as Shigella spp., remain colorless and translucent (Figure 7-4). Fermentation of lactose is a biochemical property of microorganisms. Therefore the differentiation of microorganisms relies on the expression of the pathway for the fermentation of lactose. Some organisms are considered slow fermenters and may not demonstrate a positive fermentation reaction in the first 24 hours of growth. Caution should be used in the application and interpretation of this reaction when characterizing microorganisms for identification. Phenylethyl Alcohol Agar

Phenylethyl alcohol (PEA) agar is essentially sheep blood agar that is supplemented with phenylethyl alcohol to inhibit the growth of gram-negative bacteria. The 5% sheep blood in PEA provides nutrients for common gram-positive cocci such as enterococci, streptococci, and staphylococci (Figure 7-3). Although it contains sheep blood, PEA agar should not be used in the interpretation of hemolytic reactions. Sheep Blood Agar

Most bacteriology specimens are inoculated to sheep blood agar (BA) plates, because this medium supports growth for all but the most fastidious clinically significant bacteria. In addition, the colony morphologies that commonly encountered bacteria exhibit on this medium are familiar to most clinical microbiologists. The medium consists of a base containing a protein source (e.g., tryptones), soybean protein digest (containing a slight amount of natural carbohydrate), sodium chloride, agar, and 5% sheep blood. Certain bacteria produce extracellular enzymes that lyse red blood cells in the agar (hemolysis). This activity can result in complete clearing of the red blood cells around the bacterial colony (beta [b]-hemolysis) or in only partial lysis of the cells

93

to produce a greenish discoloration around the colony (alpha [a]-hemolysis). Other bacteria have no effect on the red blood cells, and no halo is produced around the colony (gamma [g]hemolysis or nonhemolytic). Microbiologists often use colony morphology and the degree or absence of hemolysis as criteria for determining what additional steps will be necessary for identification of a bacterial isolate. To read the hemolytic reaction on a blood agar plate accurately, the technologist must hold the plate up to the light and observe the plate with the light coming from behind (i.e., transmitted light). Hemolysis, similar to lactose fermentation, relies on the production of an extracellular enzyme resulting in the lysis or partial lysis of the red blood cells. Variations in the production of the hemolysins or extracellular enzymes by the organisms may result in a different hemolytic pattern than is expected based on initial Gram stain and growth characteristics. It is therefore important for the microbiologist to carefully consider the organism identification in conjunction with additional growth characteristics and biochemical reactions. Modified Thayer-Martin Agar

Modified Thayer-Martin (MTM) agar is an enrichment and selective medium for the isolation of Neisseria gonorrhoeae, the causative agent of gonorrhea, and Neisseria meningitidis, a life-threatening cause of meningitis from specimens containing mixed microbiota. The enrichment portion of the medium is the basal components and the chocolatized blood, and the addition of antibiotics provides a selective capacity. The antibiotics include colistin to inhibit other gram-negative bacteria, vancomycin to inhibit gram-positive bacteria, and nystatin to inhibit yeast. The antimicrobial trimethoprim is also added to inhibit Proteus spp., which tend to swarm over the agar surface and mask the detection of individual colonies of the pathogenic Neisseria spp. A further modification, Martin-Lewis agar, substitutes ansamycin for nystatin and has a higher concentration of vancomycin. Thioglycollate Broth

Thioglycollate broth is the enrichment broth or semisolid media most frequently used in diagnostic bacteriology. The broth contains many nutrient factors, including casein, yeast and beef extracts, and vitamins, to enhance the growth of most medically important bacteria. Other nutrient supplements, an oxidation-reduction indicator (resazurin), dextrose, vitamin K1, and hemin have been used to modify the basic thioglycollate formula. In addition, this medium contains 0.075% agar to prevent convection currents from carrying atmospheric oxygen throughout the broth. This agar supplement and the presence of thioglycolic acid, which acts as a reducing agent to create an anaerobic environment deeper in the tube, allow anaerobic bacteria to grow. Gram-negative, facultatively anaerobic bacilli (i.e., those that can grow in the presence or absence of oxygen) generally produce diffuse, even growth throughout the broth, whereas gram-positive cocci demonstrate flocculation or clumps. Strict aerobic bacteria (i.e., require oxygen for growth), such as Pseudomonas spp., tend to grow toward the

94 PA RT I I  General Principles in Clinical Microbiology

A

B

C

D A C B

• Figure 7-8  Differential

• Figure 7-7  Growth characteristics of various bacteria in thioglycol-

late broth. A, Facultatively anaerobic gram-negative bacilli (i.e., those that grow in the presence or absence of oxygen) grow throughout the broth. B, Gram-positive cocci exhibit flocculation. C, Strictly aerobic organisms (i.e., those that require oxygen for growth), such as Pseudomonas aeruginosa, grow toward the top of the broth. D, Strictly anaerobic organisms (i.e., those that do not grow in the presence of oxygen) grow in the bottom of the broth.

surface of the broth, whereas strict anaerobic bacteria (i.e., those that cannot grow in the presence of oxygen) grow at the bottom of the broth (Figure 7-7). Although the medium provides a means to potentially identify atmospheric growth conditions, this property is not typically reportable, and therefore the medium is not considered a differential medium in the clinical laboratory. Xylose-Lysine-Deoxycholate Agar

As with HE agar, xylose-lysine-deoxycholate (XLD) agar is selective and differential for Shigella spp. and Salmonella spp. The salt, sodium deoxycholate, inhibits many gram-negative bacilli that are not enteric pathogens and inhibits grampositive organisms. A phenol red indicator in the medium detects increased acidity from carbohydrate (i.e., lactose, xylose, and sucrose) fermentation. Enteric pathogens, such as Shigella spp., do not ferment these carbohydrates, so their colonies remain colorless (i.e., the same approximate pink to red color of the uninoculated medium). Even though they often ferment xylose, colonies of Salmonella spp. are also colorless on XLD because of the decarboxylation of lysine, which results in a pH increase that causes the pH indicator to turn red. These colonies often exhibit a black center that results from Salmonella spp. producing H2S. Several of the nonpathogenic organisms ferment one or more of the sugars and produce yellow colonies (Figure 7-8).

Preparation of Artificial Media Nearly all media are commercially available as ready-to-use agar plates or tubes of broth. If media are not purchased, laboratory personnel can prepare agars and broths using

capabilities of xylose-lysine-deoxycholate (XLD) agar for lactose-fermenting, gram-negative bacilli (e.g., Escherichia coli, arrow A), non–lactose-fermenters (e.g., Shigella spp., arrow B), and H2S producers (e.g., Salmonella spp., arrow C).

dehydrated powders that are reconstituted in water (distilled or deionized) according to the manufacturers’ recommendations. Generally, media are reconstituted by dissolving a specified amount of media powder, which usually contains all necessary components, in water. Boiling is often required to dissolve the powder, but specific manufacturers’ instructions printed in media package inserts should be followed exactly. Most media require sterilization so that only bacteria from patient specimens will grow and not contaminants from water or the powdered media. Broth media are distributed to individual tubes before sterilization. Agar media are usually sterilized in large flasks or bottles capped with either plastic screw caps or plugs before being placed in an autoclave. Media Sterilization

The timing of autoclave sterilization should start from the moment the temperature reaches 121°C and usually requires a minimum of 15 minutes. Once the sterilization cycle is completed, molten agar is allowed to cool to approximately 50°C before being distributed to individual petri plates (approximately 20 to 25 mL of molten agar per plate). If other ingredients are to be added (e.g., supplements such as sheep blood or specific vitamins, nutrients, or antibiotics), they should be incorporated when the molten agar has cooled, just before distribution to plates. Delicate media components that cannot withstand steam sterilization by autoclaving (e.g., serum, certain carbohydrate solutions, certain antibiotics, and other heat-labile substances) can be sterilized by membrane filtration. Passage of solutions through membrane filters with pores ranging in size from 0.2 to 0.45 µm in diameter will not remove viruses but does effectively remove most bacterial and fungal contaminants. Finally, all media, whether purchased or prepared, must be subjected to stringent quality control before being used in the diagnostic setting (for more information regarding quality control see Chapter 77).

CHAPTER 7  Traditional Cultivation and Identification

Cell Cultures

Although most bacteria grow readily on artificial media, certain pathogens require factors provided by living cells. These bacteria are obligate intracellular parasites that require viable host cells for propagation. Although all viruses are obligate intracellular parasites, chlamydiae, rickettsiae, and rickettsiae-like organisms are bacterial pathogens that require living cells for cultivation. The cultures for growth of these bacteria comprise layers of living cells growing on the surface of a solid matrix such as the inside of a glass tube or the bottom of a plastic flask. The presence of bacterial pathogens within the cultured cells is detected by specific changes in the cells’ morphology. Alternatively, specific stains, composed of antibody conjugates, may be used to detect bacterial antigens within the cells. Cell cultures may also detect certain bacterial toxins (e.g., Clostridium difficile cytotoxin). Cell cultures are most commonly used in diagnostic virology. Cell culture maintenance and inoculation is addressed in Chapter 65.

Environmental Requirements Optimizing the environmental conditions to support the most robust growth of clinically relevant bacteria is as important as meeting the organism’s nutritional needs for in vitro cultivation. The four most critical environmental factors to consider include oxygen and carbon dioxide (CO2) availability, temperature, pH, and moisture content of the medium.

Oxygen and Carbon Dioxide Availability Most clinically relevant bacteria are aerobic, facultatively anaerobic, or strictly anaerobic. Aerobic bacteria use oxygen as a terminal electron acceptor and grow well in room air. Most clinically significant aerobic organisms are actually facultatively anaerobic, being able to grow in the presence (i.e., aerobically) or absence (i.e., anaerobically) of oxygen. However, some bacteria, such as Pseudomonas spp., members of the Neisseriaceae family, Brucella spp., Bordetella spp., and Francisella spp., are strictly aerobic and cannot grow in the absence of oxygen. Other aerobic bacteria require only low levels of oxygen (approximately 20% or less) and are referred to as being microaerophilic or microaerobic. Anaerobic bacteria are unable to use oxygen as an electron acceptor, but some aerotolerant strains will still grow slowly and poorly in the presence of oxygen. Oxygen is inhibitory or lethal for strictly anaerobic bacteria. In addition to oxygen, the availability of CO2 is important for growth of certain bacteria. Organisms that grow best with higher CO2 concentrations (i.e., 5% to 10% CO2) than is provided in room air are referred to as being capnophilic. For some bacteria, a 5% to 10% CO2 concentration is essential for successful cultivation from patient specimens.

Temperature Bacterial pathogens generally multiply best at temperatures similar to those of internal human host tissues and organs.

95

Therefore cultivation of most medically relevant bacteria uses incubators with temperatures maintained in the 35°C to 37°C range. For others, an incubation temperature of 30°C (i.e., the approximate temperature of the body’s surface) may be preferable, but such bacteria are encountered relatively infrequently, so use of this incubation temperature occurs only when dictated by special circumstances. Recovery of certain organisms can be enhanced by incubation at other temperatures. For example, the gastrointestinal pathogen Campylobacter jejuni is able to grow at 42°C. Therefore incubation at this temperature can be used as a temperature enrichment procedure. Other bacteria, such as Listeria monocytogenes and Yersinia enterocolitica, can grow at 4°C to 43°C but grow best at temperatures between 20° and 40°C. Cold enrichment has been used to enhance the recovery of these organisms in the laboratory.

pH The pH scale is a measure of the hydrogen ion concentration in the environment, with a pH value of 7 being neutral. Values less than 7 indicate the environment is acidic; values greater than 7 indicate alkaline conditions. Most clinically relevant bacteria prefer a near-neutral pH range, from 6.5 to 7.5. Commercially prepared media are buffered in this range, so checking their pH is rarely necessary.

Moisture Water is provided as a major constituent of both agar and broth media. However, when media are incubated at the temperatures used for bacterial cultivation, a large portion of water content can be lost by evaporation. Loss of water from media can be deleterious to bacterial growth in two ways: (1) less water is available for essential bacterial metabolic pathways and (2) with a loss of water, there is a relative increase in the solute concentration of the media. An increased solute concentration can osmotically shock the bacterial cell and cause lysis. In addition, increased atmospheric humidity enhances the growth of certain bacterial species. For these reasons, measures such as sealing agar plates or using humidified incubators are used to ensure appropriate moisture levels are maintained throughout the incubation period.

Methods for Providing Optimal Incubation Conditions Although heating blocks and temperature-controlled water baths may be used occasionally, incubators are the primary laboratory devices used to provide the environmental conditions required for cultivating microorganisms. The conditions of incubators can be altered to accommodate the type of organisms to be grown. This section focuses on the incubation of routine bacteriology cultures. Conditions for growing anaerobic bacteria (Part III, Section 13), mycobacteria (Part III, Section 14), fungi (Chapter 58), and viruses (Chapter 64) are covered in other areas of the text. Once inoculated with patient specimens, most media are placed in incubators with temperatures maintained between

96 PA RT I I  General Principles in Clinical Microbiology

35°C and 37°C and humidified atmospheres that contain 3% to 5% CO2. Some media that contain pH indicators cannot be placed in CO2 incubators. The presence of CO2 will acidify the media, causing the pH indicator to change color and thereby disrupt the differential properties of the media (e.g., Hektoen enteric agar and MacConkey agar). Incubators containing room air may be used for some media, but the lack of increased CO2 may hinder the growth of certain bacteria. Various atmosphere-generating systems are commercially available and are used instead of CO2-generating incubators. For example, a self-contained culture medium and a compact CO2-generating system can be used for culturing fastidious organisms such as Neisseria gonorrhoeae. A tablet of sodium bicarbonate is dissolved by the moisture created within an airtight plastic bag and releases sufficient CO2 to support growth of the pathogen. As an alternative to commercial systems, a candle jar can also generate a CO2 concentration of approximately 3% and has historically been used as a common method for cultivating certain fastidious bacteria. The burning candle, which is placed in a container of inoculated agar plates that is subsequently sealed, uses just enough oxygen before it goes out (from lack of oxygen) to lower the oxygen tension and produce CO2 and water by combustion. Other atmosphere-generating systems are available to create conditions optimal for cultivating specific bacterial pathogens (e.g., Campylobacter spp. and anaerobic bacteria). Finally, the duration of incubation required for obtaining good bacterial growth depends on the organisms being cultured. Most bacteria encountered in routine bacteriology will grow within 24 to 48 hours. Certain anaerobic bacteria may require longer incubation, and mycobacteria frequently take weeks before detectable growth occurs.

Bacterial Cultivation The process of bacterial cultivation involves the use of optimal artificial media and incubation conditions to isolate and identify the bacterial etiologies of an infection as rapidly and as accurately as possible.

Isolation of Bacteria from Specimens The cultivation of bacteria from infections at various body sites is accomplished by inoculating processed specimens directly onto artificial media. The media are summarized in Table 7-1. Incubation conditions are selected for their ability to support the growth of the bacteria most likely to be involved in the infectious process. To enhance the growth, isolation, and selection of etiologic agents, specimen inocula are usually spread over the surface of plates in a standard pattern so that individual bacterial colonies are obtained and semiquantitative analysis can be performed. A commonly used streaking technique is illustrated in Figure 7-9. Using this method, the relative numbers of organisms in the original specimen can be estimated based

on the growth of colonies past the original area of inoculation. To enhance isolation of bacterial colonies, the loop should be flamed for sterilization between the streaking of each subsequent quadrant. Streaking plates inoculated with a measured amount of specimen, such as when a calibrated loop is used to quantify colony-forming units (CFUs) in urine cultures, is accomplished by spreading the inoculum down the center of the plate. Without flaming the loop, the plate is then streaked side to side across the initial inoculum to evenly distribute the growth on the plate (Figure 7-10). This facilitates counting colonies by ensuring that individual bacterial cells will be well dispersed over the agar surface. Typically a calibrated loop of 1 mL is used for urine cultures. However, if a lower count of bacteria may be present, such as a suprapubic aspiration, a 10 mL loop may be needed to identify the lower count of organisms. The number of colonies identified on the plate is multiplied by the dilution factor to determine the number of colony-forming units per millimeter in the original specimen (103 for a 1 mL loop and 102 for a 10 mL loop). In addition, to standardize the interpretation of colony count, laboratories should have guidelines for the reporting of organisms based on the number and types of organisms present. A sample standardized method is outlined in Evolve Procedure 73-1. In addition to manual streaking, automated instrumentation is available that provides a standardized specimen processing and media inoculation. This is possible primarily because of the introduction of liquid-based swab transport devices such as the ESwab (Copan, Murrieta, CA), previously described in Chapter 5. The specimen is associated with the liquid phase or more accurately released from the swab into the transport media efficiently. The liquid-based specimen enables an automated system to retrieve the sample, inoculate a microscope slide or a smear, and inoculate a variety of media efficiently and effectively. Automated specimen processing and identification systems are covered more extensively in Chapter 12.

Evaluation of Colony Morphologies The initial evaluation of colony morphologies on the primary plating media is extremely important. Laboratorians can provide physicians with early preliminary information regarding the patient’s culture results. This information is also important for deciding how to proceed for definitive organism identification and characterization. Initial interpretation of the primary culture growth on selective, differential, or enriched media provides critical results to ensure rapid and proper treatment of the patient. The initial interpretation of the specimen cultivation, or primary plate reading, is used to correlate the growth of the organism on a variety of media in conjunction with the direct Gram stain results when included in the initial set-up of the specimen in the microbiology laboratory. For example, a sputum sample previously reported on a direct Gram stain as gram-positive diplococci in the presence of many polymorphonuclear cells

CHAPTER 7  Traditional Cultivation and Identification

Flame

Agar plate

Bacteriologic loop

1

B

Flame

2

C

3

D

A • Figure 7-9  A,

Dilution streak technique for isolation and semiquantitation of bacterial colonies. B, Actual plates show sparse, or 11, bacterial growth that is limited to the first quadrant. C, Moderate, or 21, bacterial growth that extends to the second quadrant. D, Heavy, or 31 to 41, bacterial growth that extends to the fourth quadrant.

97

98 PA RT I I  General Principles in Clinical Microbiology

Streak pattern

Liquid specimen of inoculum

B

A

• Figure 7-10  A, Streaking pattern using a calibrated loop for enumeration of bacterial colonies grown from a liquid specimen such as urine. B, An actual plate shows well-isolated and dispersed bacterial colonies for enumeration obtained with the calibrated loop streaking technique.

(PMNs) should demonstrate growth on sheep blood agar as alpha-hemolytic, translucent, umbonate colonies that also grow on chocolate agar but fail to grow on MacConkey agar, which is inhibitory to gram-positive organisms. A skilled microbiologist should recognize this as the characteristic presentation of Streptococcus pneumoniae, a common pathogen associated with bacterial pneumonia.

Type of Media Supporting Bacterial Growth As previously discussed, different media are used to recover particular bacterial pathogens. In other words, the media selected for growth is a clue to the type of organism isolated (e.g., growth on MacConkey agar indicates the organism is most likely a gram-negative bacillus). Yeast and some grampositive cocci are capable of limited growth on MacConkey agar. The incubation conditions that support growth may also be a preliminary indicator of which bacteria have been isolated (e.g., aerobic versus anaerobic bacteria).

TABLE Semi-Quantitation Grading Procedure 7-2 for Bacterial Isolates on Growth Media

Score

Number of Colonies Visible in Each Quadrant 1 (Initial Quadrant) 2 3 4

11

Less than 10

21

Less than 10

Less than 10

31

Greater than 10

Greater than 10

Less than 10

41

Greater than 10

Greater than 10

Greater than 10

Greater than 5

Note: This is a general guideline. Individual laboratories may vary in the methods used for quantitation.

Relative Quantities of Each Colony Type The predominance of a bacterial isolate is often used as one of the criteria, along with direct smear results, organism virulence, and the body site from which the culture was obtained, for establishing the organism’s clinical significance. Several methods are used for semiquantitation of bacterial quantities, including many, moderate, few, or a numerical designation (41, 31, 21) based on the number of colonies identified in each streak area (Table 7-2).

Colony Characteristics Noting key features of a bacterial colony is important for any bacterial identification; success or failure of subsequent identification procedures often depends on the accuracy of these observations. Criteria frequently used to characterize bacterial growth (colony morphology) include the following: • Colony size (usually measured in millimeters or described in relative terms such as pinpoint, small, medium, large) • Colony pigmentation

• Colony shape (includes form, elevation, and margin of the colony [Figure 7-11]) • Colony surface appearance (e.g., glistening, opaque, dull, dry, transparent) • Changes in agar media resulting from bacterial growth (e.g., hemolytic pattern on blood agar, changes in color of pH indicators, pitting of the agar surface; Figures 7-3 through 7-8) • Odor (certain bacteria produce distinct odors that can be helpful in preliminary identification) Many of these criteria are somewhat subjective, and the adjectives and descriptive terms used may vary among different laboratories. Regardless of the terminology used, nearly every laboratory’s protocol for bacterial identification begins with some agreed-upon colony description of the commonly encountered pathogens. Although careful determination of colony appearance is important, it is unwise to place total confidence on colony

CHAPTER 7  Traditional Cultivation and Identification

Colony shape

Examples

Punctiform (pinpoint) Circular (round) Filamentous Irregular Rhizoid Curled

Colony elevation Flat Raised Convex Umbonate Umbilicate Growth into media Colony margin Entire (smooth)

Irregular

Filamentous

• Figure 7-11  Colony morphologic features and descriptive terms for commonly encountered bacterial colonies.

morphology for preliminary identification. Bacteria of one species often exhibit colony characteristics that are nearly indistinguishable from those of many other species. In addition, bacteria of the same species exhibit morphologic diversity. For example, certain colony characteristics may be typical of a given species, but different strains of that species may have different morphologies.

Indirect Gram Stain and Subcultures Isolation of individual colonies during cultivation not only is important for examining morphologies and characteristics but also is necessary for timely performance of indirect Gram stains and subcultures. The Gram stain and microscopic evaluation of cultured bacteria are used with colony morphology to decide which identification steps are needed. To prevent confusion,

99

organisms from a single colony are stained. In many instances, staining must be performed on all different colony morphologies observed on the primary plate. In other cases, staining may not be necessary, because growth on a particular selective agar provides dependable evidence of the organism’s Gram stain morphology (e.g., gramnegative bacilli essentially are the only clinically relevant bacteria that grow well on MacConkey agar). After characterization of growth on primary plating media, all subsequent procedures for definitive identification require the use of pure cultures (i.e., cultures containing one strain of a single species). If sufficient inocula for testing can be obtained from the primary media, then a subculture is not necessary, except as a precaution to obtain more of the etiologic agent if needed and to ensure that a pure inoculum has been used for subsequent tests (i.e., a “purity” check). However, frequently the primary media do not yield sufficient amounts of bacteria in pure culture and a subculture step is required (Figure 7-12). Using a sterile loop, a portion of an isolated colony is taken and transferred to the surface of a suitable enrichment medium that is then incubated under conditions optimal for the organism. When making transfers for subculture, it is beneficial to flame the inoculating loop between streaks to each area on the agar surface. This prevents overinoculation of the subculture media and ensures individual colonies will be obtained. Once a pure culture is available in a sufficient amount, an inoculum for subsequent identification procedures can be prepared.

Principles of Identification Microbiologists use various methods to identify organisms cultivated from patient specimens. Although many of the principles and issues associated with bacterial identification discussed in this chapter are generally applicable to most clinically relevant bacteria, specific information regarding particular organism groups is covered in the appropriate chapters in Part III. The importance of accurate bacterial identification cannot be overstated, because identity is central to diagnostic bacteriology issues, including the following: • Determining the clinical significance of a particular pathogen (e.g., is the isolate a pathogen, a contaminant, or normal microbiota?) • Guiding physician care of the patient through presumptive and final identification methods • Determining whether laboratory testing for detection of antimicrobial resistance is warranted • Determining the type of antimicrobial therapy that is appropriate • Determining whether the antimicrobial susceptibility profiles are unusual or aberrant for a particular bacterial species • Determining whether the infecting organism is a risk for other patients in the hospital, the public, or laboratory workers (i.e., is the organism one that may pose

100 PA RT I I  General Principles in Clinical Microbiology

A

B

C • Figure 7-12  A, Mixed bacterial culture on sheep blood agar (arrows). B, Pure culture of Staphylococcus aureus (beta-hemolysis is evident). C, Streptococcus pneumoniae (alphahemolytic).

problems for infection control, public health, or laboratory safety?) • Collecting epidemiologic data to monitor the control and transmission of organisms The identification of a bacterial isolate requires analysis of information gathered from laboratory tests that provide characteristic profiles of bacteria. The tests and the order in which they are used for organism identification are often referred to as an identification scheme or workup of the organism. Identification schemes can be classified into one of two categories: (1) those based on genotypic characteristics of bacteria and (2) those based on phenotypic characteristics. Certain schemes rely on both genotypic and phenotypic characteristics. In addition, some tests, such as the Gram stain, are an integral part of many schemes used for identifying a wide variety of bacteria, whereas other tests may only be used in the identification scheme for a single species, such as the fluorescent antibody test for identification of Legionella pneumophila.

Organism Identification Using Genotypic Criteria Genotypic identification methods involve characterization of some portion of a bacterium’s genome using molecular methods for DNA or RNA analysis. This usually involves detecting the presence of a gene, or a part thereof, or an RNA product that is specific for a particular organism. In principle, the presence of a specific gene or a particular nucleic acid sequence unique to the organism is interpreted as a definitive identification of the organism. The genotypic approach is highly specific and often very sensitive. Specificity refers to the percentage of patients without disease that will test negative for the presence of the organism. Sensitivity indicates the percentage of patients in whom the organism is present who actually test positive. With the ever-expanding list of molecular methods being developed, the genetic approach to organism identification will continue to grow and become more integrated into diagnostic microbiology laboratory

CHAPTER 7  Traditional Cultivation and Identification

Microscopic Morphology and Staining Characteristics

procedures (for more information regarding molecular methods, see Chapter 8).

Microscopic evaluation of bacterial cellular morphology, as facilitated by the Gram stain or other enhancing methods discussed in Chapter 6, provides the most basic and important information on which final identification strategies are based. Based on these findings, most clinically relevant bacteria can be divided into four distinct groups: gram-positive cocci, gram-negative cocci, gram-positive bacilli, and gram-negative bacilli (Figure 7-13). Some bacterial species are morphologically indistinct and are described as “gram-negative coccobacilli,” “gram-variable bacilli,” or pleomorphic (i.e., exhibiting various shapes). Still other morphologies include curved or rods and spirals. Even without staining, examination of a wet preparation of bacterial colonies under oil immersion (10003 magnification) can provide clues as to possible identity. For example, a wet preparation prepared from a translucent, alpha-hemolytic colony on blood agar may reveal cocci in chains, a strong indication that the bacteria are probably streptococci. Also, the presence of yeast, whose colonies can closely mimic bacterial colonies but whose cells are generally much larger, can be determined (Figure 7-14). In most instances, schemes for final identification are based on the cellular morphologies and staining characteristics of bacteria. To illustrate, an abbreviated identification flowchart for commonly encountered bacteria is shown in Figure 7-13 (more detailed identification schemes are presented throughout Part III); this flowchart simply illustrates how information about microorganisms is integrated into

Organism Identification Using Phenotypic Criteria Phenotypic criteria are based on observable physical or metabolic characteristics of bacteria—that is, identification is through analysis of gene products rather than through the genes themselves. The phenotypic approach is the classic approach to bacterial classification and identification as previously discussed in Chapter 1, and most identification strategies are still based on bacterial phenotype. Other characterizations are based on the antigenic makeup of the organisms and involve techniques based on antigen-antibody interactions (for more information regarding immunologic diagnosis of infectious diseases, see Chapter 9). However, most of the phenotypic characterizations used in diagnostic bacteriology are based on tests that establish a bacterial isolate’s morphology and metabolic capabilities. The most commonly used phenotypic criteria include the following: • Microscopic morphology and staining characteristics • Macroscopic (colony) morphology, including odor and pigmentation • Environmental requirements for growth • Resistance or susceptibility to antimicrobial agents • Nutritional requirements and metabolic capabilities • Biochemical reactions including enzymatic reactions or chemical profiles

Gram stain morphology Gram-positive cocci Gram-positive bacilli Catalase +

Spores −

+

Staphylococci Streptococci Bacillus spp. or enterococci

Gram-negative bacilli

Gram-negative cocci

Growth on MacConkey agar

Growth on ThayerMartin agar

+

+

Enterobacteriaceae Haemophilus spp. Pathogenic Other Pseudomonas spp. Brucella spp. Neisseria spp. Neisseria spp. Legionella spp.

Catalase +

Corynebacterium spp. Lactobacillus spp. Listeria spp. Actinomyces spp. Others

Oxidase +

101

Pseudomonas spp. Enterobacteriaceae

Selection and performance of appropriate definitive bacterial identification schemes or systems

• Figure 7-13  Example of a bacterial identification scheme (not applicable to anaerobic organisms).

102 PA RT I I  General Principles in Clinical Microbiology

A

B

• Figure 7-14  Microscopic examination of a wet preparation demon-

strates the size difference between most yeast cells, such as those of Candida albicans (arrow A), and bacteria, such as Staphylococcus aureus (arrow B).

subsequent identification schemes that are based on the organism’s nutritional requirements and metabolic capabilities. In certain cases, staining characteristics alone are used to definitively identify a bacterial species. Examples are mostly restricted to the use of fluorescent-labeled specific antibodies and fluorescent microscopy to identify organisms such as Legionella pneumophila and Bordetella pertussis.

Macroscopic (Colony) Morphology Evaluation of colony morphology includes considering colony size, shape, odor, color (pigment), surface appearance, and any changes that colony growth produces in the surrounding agar medium (e.g., hemolysis of blood in blood agar plates). A characteristic odor can support an identification of an organism such as Pseudomonas aeruginosa, which is described as having a fruity or grapelike smell. (Note: Smelling plates in a clinical setting can be dangerous and is strongly discouraged.) Although these characteristics usually are not sufficient for establishing a final or definitive identification, the information gained provides preliminary information necessary for determining what identification procedures should follow. However, it is unwise to place too much confidence on colony morphology alone for preliminary identification of isolates. Microorganisms often grow as colonies whose appearance is not that different from many other species, especially if the colonies are relatively young (i.e., less than 14 hours old). Therefore unless colony morphology is distinctive or unless growth occurs on a particular selective medium, other characteristics must be included in the identification scheme.

Environmental Requirements for Growth Environmental conditions required for growth can be used to supplement other identification criteria. However, as

with colony morphologies, this information alone is not sufficient for establishing a final identification. The ability to grow in particular incubation atmospheres most frequently provides insight about the organism’s potential identity. For example, organisms growing only in the bottom of a tube containing thioglycollate broth are not likely to be strictly aerobic bacteria, thus eliminating these types of bacteria from the list of identification possibilities. Similarly, anaerobic bacteria can be discounted in the identification schemes for organisms that grow on blood agar plates incubated in an ambient (room) atmosphere. An organism’s requirement, or preference, for increased carbon dioxide concentrations can provide hints for the identification of other bacteria such as Streptococcus pneumoniae, Haemophilus influenzae, and Neisseria gonorrhoeae. In addition to atmosphere, the ability to survive or even thrive in temperatures that exceed or are well below the normal body temperature of 37°C may be helpful for organism identification. The growth of Campylobacter jejuni at 42°C and the ability of Yersinia enterocolitica to survive at 0°C are two examples in which temperature enrichment can be used to identify an organism.

Resistance or Susceptibility to Antimicrobial Agents The ability of an organism to grow in the presence of certain antimicrobial agents or specific toxic substances is widely used to establish preliminary identification information. This is accomplished by using agar media supplemented with inhibitory substances or antibiotics (Table 7-1) or by directly measuring an organism’s resistance to antimicrobial agents that may be used to treat infections (for more information regarding antimicrobial susceptibility testing, see Chapter 11). As discussed earlier in this chapter, most clinical specimens are inoculated to several media, including some selective or differential agars. Therefore the first clue to identification of an isolated colony is the nature of the media on which the organism is growing. For example, with rare exceptions, only gram-negative bacteria grow well on MacConkey agar. Alternatively, other agar plates, such as Columbia agar with CNA, support the growth of gram-positive organisms to the exclusion of most gram-negative bacilli. Certain agar media can be used to differentiate even more precisely than simply separating gram-negative and gram-positive bacteria. Whereas chocolate agar will support the growth of all aerobic microorganisms including Neisseria spp., the antibiotic-supplemented Thayer-Martin formulation will almost exclusively support the growth of the pathogenic species N. meningitidis and N. gonorrhoeae. Directly testing a bacterial isolate’s susceptibility to a particular antimicrobial agent may be a very useful part of an identification scheme. Many gram-positive bacteria (with a few exceptions, such as certain Enterococcus spp., Lactobacillus spp., Leuconostoc spp., and Pediococcus spp.) are susceptible to vancomycin, an antimicrobial agent that acts on the bacterial cell wall. In contrast, most clinically

CHAPTER 7  Traditional Cultivation and Identification

important gram-negative bacteria are resistant to vancomycin. Therefore when organisms with uncertain Gram stain results are encountered, susceptibility to vancomycin can be used to help establish the organism’s Gram “status.” Any zone of inhibition around a vancomycinimpregnated disk after overnight incubation is usually indicative of a gram-positive bacterium (Figure 7-15). It is important to understand that with the increasing use of antibiotics to treat serious infections, some gram-positive organisms have acquired mechanisms of resistance to vancomycin. With few exceptions (e.g., certain Chryseobacterium spp., Moraxella spp., or Acinetobacter spp. isolates may be vancomycin susceptible), truly gram-negative bacteria are resistant to vancomycin. Conversely, most gram-negative bacteria are susceptible to the antibiotics colistin or polymyxin, whereas gram-positive bacteria are typically resistant to these agents.

Nutritional Requirements and Metabolic Capabilities Determining the nutritional and metabolic capabilities of a bacterial isolate is the most common approach used for determining the genus and species of an organism. The methods available for making these determinations share many commonalties but also have some important differences. In general, all methods use a combination of tests to establish the enzymatic capabilities of a given bacterial isolate as well as the isolate’s ability to grow or survive the presence of certain inhibitors (e.g., salts, surfactants, toxins, and antibiotics). Establishing Enzymatic Capabilities

As discussed in Chapter 2, enzymes are the driving force in bacterial metabolism. Because enzymes are genetically encoded, the enzymatic content of an organism is a direct reflection of the organism’s genetic makeup, which, in turn, is specific for individual bacterial species.

A

B

Types of Enzyme-Based Tests

In diagnostic bacteriology, enzyme-based tests are designed to measure the presence of a specific enzyme or a complete metabolic pathway that may contain several different enzymes. Although the specific tests most useful for the identification of particular bacteria are discussed in Part III, some examples of tests commonly used to characterize a wide spectrum of bacteria are reviewed here. Single Enzyme Tests

Several tests are commonly used to determine the presence of a single enzyme. These tests usually provide rapid results because they can be performed on organisms already grown in culture. Of importance, these tests are easy to perform and interpret and often play a key role in the identification scheme. Although most single enzyme tests do not yield sufficient information to provide species identification, they are used extensively to determine which subsequent identification steps should be followed. For example, the catalase test can provide pivotal information and is commonly used in schemes for gram-positive identifications. The oxidase test is of comparable importance in identification schemes for gram-negative bacteria (Figure 7-13). Catalase Test

The enzyme catalase catalyzes the release of water and oxygen from hydrogen peroxide (H2O2 1 catalase d H2O 1 O2); its presence is determined by direct analysis of a bacterial culture (Procedure 12-8). The rapid production of bubbles (effervescence) when bacterial growth is mixed with a hydrogen peroxide solution is interpreted as a positive test (i.e., the presence of catalase). Failure to produce effervescence or weak effervescence is interpreted as negative. If the bacterial inoculum is inadvertently contaminated with red blood cells when the test inoculum is collected from a sheep blood agar plate, weak production of bubbles may occur, but this should not be interpreted as a positive test. Because the catalase test is key to the identification scheme of many gram-positive organisms, interpretation must be completed carefully. For example, staphylococci are catalase-positive, whereas streptococci and enterococci are negative; similarly, the catalase reaction differentiates Listeria monocytogenes and corynebacteria (catalasepositive) from other gram-positive, non–spore-forming bacilli (Figure 7-13). Oxidase Test

• Figure 7-15  A, Zone of growth inhibition around the 5-µg vancomycin

disk is indicative of a gram-positive bacterium. B, The gram-negative organism is not inhibited by this antibiotic, and growth extends to the edge of the disk.

103

Cytochrome oxidase participates in electron transport and in the nitrate metabolic pathways of certain bacteria. Testing for the presence of oxidase can be performed by flooding bacterial colonies on the agar surface with 1% tetramethylp-phenylenediamine dihydrochloride. Alternatively, a sample of the bacterial colony can be rubbed onto filter paper impregnated with the reagent (Procedure 12-33). A positive reaction is indicated by the development of a purple color. If an iron-containing wire is used to transfer growth, a false-positive reaction may result; therefore, platinum wire or

104 PA RT I I  General Principles in Clinical Microbiology

wooden sticks are recommended. Certain organisms may show slight positive reactions after the initial 10 seconds have passed; such results are not considered definitive. The test is initially used for differentiating between groups of gram-negative bacteria. Among the commonly encountered gram-negative bacilli, Enterobacteriaceae, Stenotrophomonas maltophilia, and Acinetobacter spp. are oxidase-negative, whereas many other bacilli, such as Pseudomonas spp. and Aeromonas spp., are positive (Figure 7-13). The oxidase test is also a key reaction for the identification of Neisseria spp. (oxidase-positive).

Hippuricase is a constitutive enzyme that hydrolyzes the substrate hippurate to produce the amino acid glycine. Glycine is detected by oxidation with ninhydrin reagent, which results in the production of a deep purple color (Procedure 12-19). The hippurate test is most frequently used in the identification of Gardnerella vaginalis, Streptococcus agalactiae, Campylobacter jejuni, and Listeria monocytogenes.

Indole Test

Tests for the Presence of Metabolic Pathways

Bacteria that produce the enzyme tryptophanase are able to degrade the amino acid tryptophan into pyruvic acid, ammonia, and indole. Indole is detected by combining with an indicator, aldehyde ([4-dimethylamino] benzaldehyde, 37% hydrochloric acid, and amyl alcohol, also referred to as Kovac’s reagent), which results in a pink to red color formation (Procedure 12-20). Spot indole contains p-dimethylaminocinnamaldehyde (DMACA), 37% hydrochloric acid, and deionized water, which results in a blue color formation. This test is used in numerous identification schemes, especially to presumptively identify Escherichia coli, the gram-negative bacillus most commonly encountered in diagnostic bacteriology. Urease Test

Urease hydrolyzes the substrate urea into ammonia, water, and carbon dioxide. The presence of the enzyme is determined by inoculating an organism to broth (Stuart’s urea broth) or agar (Christensen’s urea agar) containing urea as the primary carbon source followed by detecting the production of ammonia (Procedure 12-41). Ammonia increases the pH of the medium so its presence is readily detected using a pH indicator. Change in medium pH is a common indicator of metabolic process and, because pH indicators change color with increases (alkalinity) or decreases (acidity) in the medium’s pH, they are commonly used in many identification test schemes. Prolonged incubation of urea agar may result in false positive reactions because of the hydrolysis of proteins in the medium. In addition, weak urease positive organisms such as Enterobacter spp. may not demonstrate a positive reaction in urea broth because of the buffering capacity of the media. The urease test helps identify certain species of Enterobacteriaceae, such as Proteus spp., and other important bacteria such as Corynebacterium urealyticum and Helicobacter pylori. PYR Test

The enzyme L-pyroglutamyl-aminopeptidase (PYR) hydrolyzes the substrate L-pyrrolidonyl-b-naphthylamide to produce a beta-naphthylamine. When the beta-naphthylamine combines with a cinnamaldehyde reagent, a bright red color is produced (Procedure 12-36). The PYR test is particularly helpful in identifying gram-positive cocci such as Streptococcus

pyogenes and Enterococcus spp., which test positive, whereas other streptococci test negative. Hippurate Hydrolysis

Several identification schemes are based on determining what metabolic pathways an organism uses and the substrates processed by these pathways. In contrast to single enzyme tests, these pathways may involve several interactive enzymes. The presence of an end product resulting from these interactions is measured in the testing system. Assays for metabolic pathways can be classified into three general categories: carbohydrate oxidation and fermentation, amino acid degradation, and single substrate utilizations. Oxidation and Fermentation Tests

As discussed in Chapter 2, bacteria use various metabolic pathways to produce biochemical building blocks and energy. For most clinically relevant bacteria, this involves utilization of carbohydrates (e.g., sugar or sugar derivatives) and protein substrates. Determining whether substrate utilization is an oxidative or fermentative process is important for the identification of several different bacteria. Oxidative processes require oxygen; fermentative ones do not. The clinical laboratory determines how an organism utilizes a substrate by observing whether acid byproducts are produced in the presence or absence of oxygen (fermentation). In most instances, the presence of acid byproducts is detected by a change in the pH indicator incorporated into the medium. The color changes that occur in the presence of acid depend on the type of pH indicator used. Oxidation-fermentation determinations are usually accomplished using a special semisolid medium (oxidativefermentative [O-F] medium) that contains low concentrations of peptone and a single carbohydrate substrate such as glucose. The organism to be identified is inoculated into two glucose O-F tubes, one of which is then overlaid with mineral oil as a barrier to oxygen. Common pH indicators used for O-F tests, and the color changes they undergo with acidic conditions, include bromcresol purple, which changes from purple to yellow; Andrade’s acid fuchsin indicator, which changes from pale yellow to pink; phenol red, which changes from red to yellow; and bromthymol blue, which changes from green to yellow. As shown in Figure 7-16, when acid production is detected in both tubes, the organism is identified as a glucose fermenter, because fermentation can occur with or without oxygen. If acid is only detected in the open, aerobic tube,

CHAPTER 7  Traditional Cultivation and Identification

105

Mineral oil overlay

Both tubes of O-F glucose inoculated with test organism

Incubation

Oxidizer (nonfermenter)

Fermenter

Nonutilizer

• Figure 7-16  Principle

of glucose oxidative-fermentation (O-F) test. Fermentation patterns shown in O-F tubes include examples of oxidative, fermentative, and nonutilizing bacteria.

the organism is characterized as a glucose oxidizer. As a third possibility, some bacteria do not use glucose as a substrate and no acid is detected in either tube (a nonutilizer). The glucose fermentative or oxidative capacity is generally used to separate organisms into major groups (e.g., Enterobacteriaceae are fermentative; Pseudomonas spp. are oxidative). However, the utilization pattern for several other carbohydrates (e.g., lactose, sucrose, xylose, maltose) is often needed to help identify an organism’s genus and species. Amino Acid Degradation

Determining the ability of bacteria to produce enzymes that either deaminate, dihydrolyze, or decarboxylate certain amino acids is often used in identification schemes. The amino acid substrates most often tested include lysine, tyrosine, ornithine, arginine, and phenylalanine. (The indole test for tryptophan cleavage is presented earlier in this chapter.) Decarboxylases cleave the carboxyl group from amino acids so that amino acids are converted into amines; lysine is converted to cadaverine, and ornithine is converted to putrescine. Because amines increase medium pH, they are readily detected by color changes in a pH indictor indicative of alkalinity. Decarboxylation is an anaerobic process that requires an acid environment for activation. The most common medium used for this test is Moeller decarboxylase base that contains glucose, the amino acid substrate of interest (i.e., lysine, ornithine, or arginine), and a pH indicator.

Organisms are inoculated into the tube medium, which is then overlaid with mineral oil to ensure anaerobic conditions (see Chapter 12). Early during incubation, bacteria utilize the glucose and produce acid, resulting in a yellow coloration of the pH indicator. Organisms that can decarboxylate the amino acid then begin to attack the substrate and produce the amine product, which increases the pH and changes the indicator back from yellow to purple (if bromcresol purple is the pH indicator used; red if phenol red is the indicator). Therefore after overnight incubation, a positive test is indicated by a purple color, and a negative test (i.e., lack of decarboxylase activity) is indicated by a yellow color. With each amino acid tested, a control tube of the glucose-containing broth base without amino acid is inoculated. The standard’s (control) color is compared with that of the tube containing the amino acid after incubation. Because it is a two-step process, the breakdown of arginine is more complicated than that of lysine or ornithine. Arginine is first dehydrolyzed to citrulline, which is subsequently converted to ornithine. Ornithine is then decarboxylated to putrescine, which results in the same pH indicator changes as just outlined for the other amino acids. Unlike decarboxylation, deamination, the cleavage of the amine group from an amino acid, occurs in air. Deamination of the amino acid phenylalanine results in the presence of the end product (phenylpyruvic acid). Phenylpyruvic acid is detected by the addition of 10% ferric chloride, which results in the development of a green color. An agar slant medium,

106 PA RT I I  General Principles in Clinical Microbiology

phenylalanine deaminase agar (PDA), is commercially available for this test. Lysine iron agar medium is a combination medium used for the identification of decarboxylation and deamination in a single tube. Dextrose is incorporated in the medium in a limited concentration of 0.1%. The organism is then stabbed into the media approximately within 3 mm of the bottom of the tube. When removing the inoculating needle from the stab, the slant of the medium is streaked. Organisms capable of dextrose fermentation will produce acid resulting in a yellow butt. Organisms that decarboxylate lysine will produce alkaline products that will return the yellow color to the original purple color of the medium. Hydrogen sulfide–positive organisms produce gas that reacts with iron salts, ferrous sulfate, and ferric ammonium citrate in the media, producing a black precipitate. It is important to note that Proteus spp. are capable of deaminating lysine in the presence of oxygen, resulting in a red color change on the slant of the medium. Single Substrate Utilization

Whether an organism can grow in the presence of a single nutrient or carbon source provides useful identification information. Such tests entail inoculating organisms to a medium that contains a single source of nutrition (e.g., citrate, malonate, or acetate) and, after incubation, observing the medium for growth. Growth is determined by observing the presence of bacterial colonies or by using a pH indicator to detect end products of metabolic activity. Establishing Inhibitor Profiles

The ability of a bacterial isolate to grow in the presence of one or more inhibitory substances can provide valuable identification information. Examples regarding the use of inhibitory substances are presented earlier in this chapter. In addition to the information gained from using inhibitory media or antimicrobial susceptibility testing, other more specific tests may be incorporated into bacterial identification schemes. Because most of these tests are used to identify a particular group of bacteria, their protocols and principles are discussed in the appropriate chapters in Part III. A few examples of such tests include the following: • Growth in the presence of various NaCl concentrations (identification of Enterococci spp. and Vibrio spp.) • Susceptibility to optochin and solubility in bile (identification of Streptococcus pneumoniae) • Ability to hydrolyze esculin in the presence of bile (identification of Enterococci spp. in combination with NaCl) • Ethanol survival (identification of Bacillus spp.)

Principles of Phenotypic Identification Schemes As shown in Figure 7-13, growth characteristics, microscopic morphologies, and single test results are used to categorize most bacterial isolates into general groups. However, the

definitive identification to species requires use of schemes designed to produce metabolic profiles of the organisms. Identification systems usually consist of four major components (Figure 7-17): • Selection and inoculation of a set (i.e., battery) of specific metabolic substrates and growth inhibitors • Incubation to allow substrate utilization to occur or to allow growth inhibitors to act • Determination of metabolic activity that occurred during incubation • Analysis of metabolic profiles and comparison with established profile databases for known bacterial species to establish definitive identification

Selection and Inoculation of Identification Test Battery The number and types of tests that are selected for inclusion in a battery depends on various factors, including the type of bacteria to be identified, the clinical significance of the bacterial isolate, and the availability of reliable testing methods.

Type of Bacteria to Be Identified Certain organisms have such unique features that relatively few tests are required to establish identity. For example, Staphylococcus aureus is essentially the only gram-positive cocci that appears microscopically in clusters, is catalase-positive, and produces coagulase. Therefore identification of this common pathogen usually requires the use of only two tests coupled with colony and microscopic morphology. In contrast, identification of most clinically relevant gram-negative bacilli, such as those of the Enterobacteriaceae family, requires establishing metabolic profiles often involving 20 or more tests.

Clinical Significance of the Bacterial Isolate Although a relatively large number of tests may be required to identify a particular bacterial species, the number of tests actually inoculated may depend on the clinical significance of an isolate. For instance, if a gram-negative bacillus is mixed with five other bacterial species in a urine culture, it is likely to be a contaminant. In this setting, multiple tests to establish species identity are not warranted and should not routinely be performed. However, if this same organism is isolated in pure culture from cerebrospinal fluid, the full battery of tests required for definitive identification should be performed.

Availability of Reliable Testing Methods Because of an increasing population of immunocompromised patients and the increasing multitude of complicated medical procedures, the isolation of uncommon or unusual bacteria is occurring more frequently. Because of the unusual nature exhibited by some of these bacteria, reliable testing methods and identification criteria may not be established in most clinical laboratories. In these instances, only the genus of the organism may be identified (e.g., Bacillus spp.), or identification may not go beyond a description of the organism’s microscopic morphology (e.g., gram-positive, pleomorphic bacilli, or

CHAPTER 7  Traditional Cultivation and Identification

1.

107

Selection and inoculation of tests • Number and type of tests selected depend on type of organism to be identified, clinical significance of isolates, and availability of reliable methods. • Identification systems must be inoculated with pure cultures.

2.

Incubation for substrate utilization • Duration depends on whether bacterial multiplication is or is not required for substrate utilization (i.e., growth-based test vs. a non–growthbased test).

3.

Detection of metabolic activity (substrate utilization) • Colorimetry, fluorescence, or turbidity are used to detect products of substrate utilization. • Detection is done visually or with the aid of various photometers.

4.

Analysis of metabolic profiles • Involves conversion of substrate utilization profile to a numeric code (see Figure 7-18) • Computer-assisted comparison of numeric code with extensive taxonomic database provides most likely identification of the bacterial isolate. • For certain organisms for which identification is based on a few tests, extensive testing and analysis are not routinely needed.

• Figure 7-17  Four basic components of bacterial identification schemes and systems.

gram-variable, branching organism). When such bacteria are encountered and are thought to be clinically significant, they should be sent to a reference laboratory whose personnel are experienced in identifying unusual organisms. Although the number of tests included in an identification battery may vary and different identification systems may require various inoculation techniques, the one common feature of all systems is the requirement for inoculation with a pure culture. Inoculation with a mixture of bacteria produces mixed and often uninterpretable results. To expedite identification, cultivation strategies (described earlier in this chapter) should focus on obtaining pure cultures as soon as possible. Furthermore, positive and negative controls should be run in parallel with most identification systems as a check for purity of the culture used to inoculate the system.

Incubation for Substrate Utilization The time required to obtain bacterial identification depends heavily on the length of incubation needed before the test result is available. In turn, the duration of incubation

depends on whether the test is measuring metabolic activity that requires bacterial growth or whether the assay is measuring the presence of a particular enzyme or cellular product that can be detected without the need for bacterial growth.

Conventional Identification Because the generation time (i.e., the time required for a bacterial population to double) for most clinically relevant bacteria is 20 to 30 minutes, growth-based tests usually require hours of incubation before the presence of an end product can be measured. Many conventional identification schemes require 18 to 24 hours of incubation, or longer, before the tests can be accurately interpreted. Although the conventional approach has been the standard for most bacterial identification schemes, the desire to produce results and identifications in a more timely fashion has resulted in the development of rapid identification strategies.

Rapid Identification In the context of diagnostic bacteriology, the term rapid is relative. In some instances a rapid method is one that provides

108 PA RT I I  General Principles in Clinical Microbiology

Matrix-Assisted Laser Desorption Ionization Time of Flight Mass Spectrometry

a result the same day that the test was inoculated. Alternatively, the definition may be more precise, whereby rapid is only used to describe tests that provide results within 4 hours of inoculation. It is important to note that rapid identification still requires overnight incubation of culture media from the primary specimen. Pure culture isolates grown on culture media are required for use in rapid identification systems. Two general approaches have been developed to obtain more rapid identification results. One is to vary the conventional testing approach by decreasing the test substrate medium volume and increasing the concentration of bacteria in the inoculum. Several conventional methods, such as carbohydrate fermentation profiles, use this strategy for more rapid results. The second approach uses unique or unconventional substrates. Particular substrates are chosen, based on their ability to detect enzymatic activity at all times. That is, detection of the enzyme does not depend on multiplication of the organism (i.e., not a growth-based test), so delays caused by depending on bacterial growth are minimized. The catalase, oxidase, and PYR tests discussed previously are examples of such tests, but many others are available as part of commercial testing batteries. Still other rapid identification schemes are based on antigen-antibody reactions, such as latex agglutination tests, that are commonly used to quickly and easily identify certain beta-hemolytic streptococci and S. aureus (for more information regarding these test formats, see Chapter 9).

A

Matrix-assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF MS) is an advanced chemical technique that uses laser excitation to ionize chemical functional groups that are included in the proteins of an organism. MALDI-TOF MS has the potential to significantly reduce turnaround time and identification rates, while at the same time reducing the cost of consumables in the microbiology laboratory (Figure 7-18). The organism is either applied directly onto a plate from a pure culture or prepared as a protein extract before application. The sample is then mixed with a chemical matrix. The laser is applied to the sample, and the matrix absorbs the energy, transferring heat to the sample proteins and creating ions; this is essentially the desorption and ionization process. These ions are then separated in a tube referred to as a flight tube. The lighter the ions, the faster they will travel in the tube. The ions are then measured using a detector, and a protein spectrum for the specific organism is then created as a mass spectrum using a mass-to-charge ratio and signal intensity. Typically the proteins that are detected efficiently would include small relatively abundant proteins such as ribosomal proteins. This new organism protein profile can then be compared with other organisms included in a computerized database. As of this writing, there are a few commercially available MALDI-TOF MS systems, including MALDI Biotyper (Bruker Daltonics Inc, Fremont, CA) and Vitek MS (BioMerieux, Etoile, France). However, clinical identification of microorganisms including bacteria, fungi, and

B

• Figure 7-18  A, Matrix-assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF).

B, A colony from a primary culture plate is transferred to a “spot” on a target plate. Cells are then treated with formic acid on the target plate and dried and then a matrix is added. The plate is placed into the mass spectrometer for analysis, and a mass spectrum is generated and compared with the database, providing an identification of the organism. (Photos courtesy of Cory Gunderson, Avera Regional Laboratory, Sioux Falls, SD).

CHAPTER 7  Traditional Cultivation and Identification

viruses is limited to the size of the proprietary database. The technique is also limited to the identification of organisms from pure colony isolation and is not useful on specimens containing contaminating microbiota or multiple species. Additional disadvantages associated with laboratory technique include smearing between organisms on the testing plate and failure to properly clean the plates before subsequent use. As long as the quality of the technical process is maintained, results are generally reproducible. Additional errors may include variation in the composition of the solvent and matrix, culture conditions, the organism’s biologic variation, and poorly developed quality-control strategies. Further information and the application of MALDI-TOF MS in the identification of specific microorganisms is provided in Parts III and V.

109

combinations hasten identification and increase the variety of organisms that can be reliably identified.

Fluorescence There are two basic strategies for using fluorescence to measure metabolic activity. In one approach, substrate-fluorophore complexes are used. If a bacterial isolate processes the substrate, the fluorophore is released and assumes a fluorescent configuration. Alternatively, pH changes resulting from metabolic activity can be measured by changes in fluorescence of certain fluorophore markers. In these pH-driven, fluorometric reactions, pH changes result in either the fluorophore becoming fluorescent or, in other instances, fluorescence being quenched or lost. To detect fluorescence, ultraviolet light of appropriate wavelength is focused on the reaction mixture and a special kind of photometer, a fluorometer, measures fluorescence.

Detection of Metabolic Activity

Turbidity

The accuracy of an identification scheme heavily depends on the ability to reliably detect whether a bacterial isolate has utilized the substrates composing the identification battery. The sensitivity and strength of the detection signal can also contribute to how rapidly results are available. No matter how quickly an organism may metabolize a particular substrate, if the end products are slowly or weakly detected, the ultimate production of results will still be “slow.” Detection strategies for determining the end products of different metabolic pathways use colorimetry, fluorescence, or turbidity.

Turbidity measurements are not commonly used for bacterial identifications but do have widespread application for determining growth in the presence of specific growth inhibitors, including antimicrobial agents, and for detecting bacteria present in certain clinical specimens. Turbidity is the ability of particles in suspension to refract and deflect light rays passing through the suspension such that the light is reflected back into the eyes of the observer. The optical density (OD), a measurement of turbidity, is determined in a spectrophotometer. This instrument compares the amount of light that passes through the suspension (the percent transmittance) with the amount of light that passes through a control suspension without particles. A photoelectric sensor, or photometer, converts the light that impinges on its surface to an electrical impulse, which can be quantified. A second type of turbidity measurement is obtained by nephelometry, or light scatter. In this case the photometers are placed at angles to the suspension, and the scattered light, generated by a laser or incandescent bulb, is measured. The amount of light scattered depends on the number and size of the particles in suspension.

Colorimetry Several identification systems measure color change (colorimetry) to detect the presence of metabolic end products. Frequently the color change is produced using pH indicators included in the media. Depending on the byproducts to be measured and the testing method, additional reagents may need to be added to the reaction before the results are interpreted. An alternative to the use of pH indicators is the oxidation-reduction potential indicator tetrazolium violet. Organisms are inoculated into wells that contain a single, utilizable carbon source. Metabolism of that substrate generates electrons that reduce the tetrazolium violet, producing a purple color (positive reaction) that can be spectrophotometrically detected. In a third approach, the substrates themselves may be chromogenic so that when they are “broken down” by the organism, the altered substrate produces a color. Some commercial systems use a miniaturized modification of conventional biochemical batteries, with the color change being detectable with the unaided eye. Alternatively, in certain automated systems, a photoelectric cell measures the change in the wavelength of light transmitted through miniaturized growth cuvettes or wells, thus eliminating the need for direct visual interpretation by laboratory personnel. In addition, a complex combination of dyes and filters may be used to enhance and broaden the scope of substrates and color changes that can be used in such systems. These

Analysis of Metabolic Profiles The metabolic profile obtained with a particular bacterial isolate is essentially the phenotypic fingerprint, or signature, of that organism. Typically, the profile is recorded as a series of pluses (1) for positive reactions and minuses (–) for negative or nonreactions (Figure 7-19). Although this profile by itself provides little information, microbiologists can compare the profile with an extensive identification database to establish the identity of that specific isolate.

Identification Databases Reference databases are available for clinical use. These databases are maintained by manufacturers of identification systems and are based on the continuously updated taxonomic status of clinically relevant bacteria. Although microbiologists typically do not establish and maintain their own databases,

110 PA RT I I  General Principles in Clinical Microbiology

Test/ substrate

Test results (− or +)

Octal code conversion*

Binary code conversion Octal (0 or 1) value

Octal score

1 2 3

ONPG Arginine dihydrolase Lysine decarboxylase

+ − +

1 0 1

×1 ×2 ×4

1 0 4

4 5 6 7 8 9

Ornithine decarboxylase Citrate utilization H2S production Urea hydrolysis Tryptophane deaminase Indole production

+ − − − − +

1 0 0 0 0 1

× × × × × ×

1 2 4 1 2 4

1 0 0 0 0 4

10 11 12

VP test Gelatin hydrolysis Glucose fermentation

− − +

0 0 1

×1 ×2 ×4

0 0 4

13 14 15 16 17 18

Mannitol fermentation Inositol fermentation Sorbitol fermentation Rhamnose fermentation Sucrose fermentation Melibiose fermentation

+ − + + + +

1 0 1 1 1 1

× × × × × ×

1 2 4 1 2 4

1 0 4 1 2 4

19 20 21

Amygdalin fermentation Arabinose fermentation Oxidase production

− + −

0 1 0

×1 ×2 ×4

0 2 0

Octal triplet total

Octal profile

5

1

4

4

5144572 (E. coli )

5

7

2

*As derived from API 20E (bioMérieux, Inc.) for identification of Enterobacteriaceae.

• Figure 7-19  ​Example of converting a metabolic profile to an octal profile for bacterial identification.

an overview of the general approach provides background information. The first step in developing a database is to accumulate many bacterial strains of the same species. Each strain is inoculated to an identical battery of metabolic tests to generate a positive-negative test profile. The cumulative results of each test are expressed as a percentage of each genus or species that possesses that characteristic. For example, suppose that 100 different known E. coli strains and 100 known Shigella spp. strains are tested in four biochemicals, yielding the results illustrated in Table 7-3. In reality, many more strains and tests would be performed. However, the principle—to generate a database for each species that contains the percentage probability for a positive result with each test in the battery—is the same. Manufacturers develop databases for each of the identification systems they produce for diagnostic use (e.g., Enterobacteriaceae, gram-positive cocci, nonfermentative gram-negative bacilli). Because the data are based on organism “behavior” in a particular commercial system, the databases cannot and should not be applied to interpret profiles obtained by other testing methods. Furthermore, most databases are established with the assumption that the isolate to be identified has been appropriately characterized using adjunctive tests. For example, if a S. aureus isolate is mistakenly tested using a system for identification of Enterobacteriaceae, the database will not identify the gram-positive cocci, because the results obtained will only be compared with data available for enteric bacilli. This underscores the importance of accurately performing

TABLE Generation and Use of Genus-Identification Database Probability: Percentage of Positive 7-3

Reactions for 100 Known Strains

Biochemical Parameter

Organism

Lactose

Sucrose

Indole

Ornithine

Escherichia spp.

91

49

99

63

1

1

38

20

Shigella spp.

preliminary tests and observations, such as colony and Gram stain morphologies, before selecting a particular identification battery.

Use of the Database to Identify Unknown Isolates Once a metabolic profile has been obtained with a bacterial isolate of unknown identity, the profile must be converted to a numeric code that will facilitate comparison of the unknown organism’s phenotypic fingerprint with the appropriate database. To exemplify this step in the identification process, a binary code conversion system that uses the numerals 0 and 1 to represent negative and positive metabolic reactions, respectively, is used as an example (although other strategies are now used). As shown in Figure 7-19, using binary code conversion, a 21-digit binomial number (e.g., 101100001001101111010, as read from top to bottom in the figure) is produced from the test result. This number is then used in an octal code

CHAPTER 7  Traditional Cultivation and Identification

conversion scheme to produce a mathematic number (octal profile [Figure 7-19]). The octal profile number is used to generate a numerical profile distinctly related to a specific bacterial species. As shown in Figure 7-19, the octal profile for the unknown organism is 5144572. This profile would then be compared with database profiles to determine the most likely identity of the organism. In this example, the octal profile indicates the unknown organism is E. coli. Confidence in Identification

Once metabolic profiles have been translated into numeric scores, the probability that a correct correlation with the database has been made must be established—that is, how confident the laboratorian can be that the identification is correct. This is accomplished by establishing the percentage probability, which is usually provided as part of most commercially available identification database schemes. For example, unknown organism X is tested against the four biochemicals listed in Table 7-3 and yields results as follows: lactose (1), sucrose (1), indole (–), and ornithine (1). Based on the results of each test, the percentage of known strains in the database that produced positive results are used to calculate the percentage probability that strain X is a member of one of the two genera (Escherichia or Shigella) given in the example (Table 7-4). Therefore if 91% of Escherichia spp. are lactose-positive (Table 7-3), the probability that X is a species of Escherichia based on lactose alone is 0.91. If 38% of Shigella spp. are indole positive (Table 7-3), then the probability that X is a species of Shigella based on indole alone is 0.62 (1.00 [all Shigella] – 0.38 [percent positive Shigella] 5 0.62 [percent of all Shigella that are indole negative]). The probabilities of the individual tests are then multiplied to achieve a calculated likelihood that X is one of these two genera. In this example, X is more likely to be a species of Escherichia, with a probability of 357:1 (1 divided by 0.0028; see Table 7-4). This is still a very unlikely probability for correct identification, but only four parameters were tested, and the indole result was atypical. As more TABLE Generation and Use of Genus-Identification 7-4 Database Probability: Probability That

Unknown Strain X Is a Member of a Known Genus Based on Results of Each Individual Parameter Tested Biochemical Parameter

Organism

Lactose

Sucrose

Indole

Ornithine

1

1

1

Escherichia spp.

0.91

0.49

0.01

0.63

Shigella spp.

0.01

0.01

0.62

0.20

X

Probability that X is Escherichia 5 0.91 3 0.49 3 0.01 3 0.63 5 0.002809. Probability that X is Shigella 5 0.01 3 0.01 3 0.62 3 0.20 5 0.000012.

111

parameters are added to the formula, the importance of just one test decreases, and the overall pattern prevails. With many organisms being tested for 20 or more reactions, computer-generated databases provide the probabilities. As more organisms are included in the database, the genus and species designations and probabilities become more precise. Also, with more profiles in a database, the unusual patterns can be more readily recognized and, in some cases, new or unusual species may be discovered. The most common commercial suppliers of multicomponent identification systems are driven by patent information technology and data management systems that automatically provide analysis and outcome of the metabolic process and identification.

Commercial Identification Systems and Automation Advantages and Examples of Commercial System Designs Commercially available identification systems have largely replaced compilations of conventional test media and substrates prepared in-house for bacterial identification. This replacement has mostly come about because the design of commercial systems has continuously evolved to maximize the speed and optimize the convenience with which all four identification components shown in Figure 7-17 can be achieved. Because laboratory workload has increased and the qualified workforce continues to decrease, conventional methodologies have had difficulty competing with the advantages of convenience and updated databases offered by commercial systems. Table 12-1 lists and describes the most common manual and automated bacterial identification systems available. Some of the simplest multitest commercial systems consist of a conventional format that can be inoculated once to yield more than one result. By combining reactants, for example, one substrate can be used to determine indole and nitrate results; indole and motility results; motility, indole, and ornithine decarboxylase; or other combinations. Alternatively, conventional tests have been assembled in smaller volumes and packaged so that they can be inoculated easily with one manipulation instead of several. When used in conjunction with a computer-generated database, species identifications are made relatively easily. Another approach is to have substrates dried in plastic cupules that are arranged in series on strips into which a suspension of the test organism is placed (Figure 7-20). For some of these systems, use of a heavy inoculum or use of substrates with a utilization that is not dependent on extended bacterial multiplication allows results to be available after 4 to 6 hours of incubation. Still other identification battery formats have been designed to more fully automate several aspects of the identification process. One example is the use of “cards” that are substantially smaller than most microtiter trays or cupule strips (Figure 7-21). Analogous to the microtiter tray format,

112 PA RT I I  General Principles in Clinical Microbiology

platforms, kits, and assays are still needed for unusual pathogens or fastidious organisms that fail to grow. In addition, some clinical isolates of microorganisms may produce a biofilm or be too viscous for the automated instrument, resulting in a failed attempt at identification. The complexity of microbial identification, despite automation, still requires the knowledge and understanding to correlate automated results and reactions with the phenotypic colonial morphology to ensure proper patient care and treatment.

Overview of Commercial Identification Systems • Figure 7-20  ​Biochemical

test panel (API; bioMérieux, Inc., Hazelwood, MO). The test results obtained with the substrates in each cupule are recorded, and an organism identification code is calculated by octal code conversion on the form provided. The octal profile obtained then is matched with an extensive database to establish organism identification.

• Figure 7-21  ​Vitek

cards composed of multiple wells containing dried substrates that are reconstituted by inoculation with a bacterial suspension (bioMérieux, Inc., Hazelwood, MO). Test results in the card wells are automatically read by the manufacturer’s reading device.

these cards contain dried substrates in tiny wells that are resuspended upon inoculation. Commercial systems are often categorized as either automated or manual. As shown in Table 12-1, various aspects of an identification system can be automated, and these usually include, in whole or in part, specimen processing, the inoculation steps, the incubation, the preliminary plate reading and the reading of biochemical tests, and the analysis of results. However, no strict criteria exist that state how many aspects must be automated for a whole system to be classified as automated. Therefore whether a system is considered automated can be controversial. Furthermore, regardless of the lack or level of automation, the selection of a cultivation and identification system ultimately depends on system accuracy and reliability, whether the system meets the needs of the laboratory, and limitations imposed by laboratory financial resources. Despite the technological advances of automated specimen processing, plating, and identification systems, nonautomated

Various multitest bacterial identification systems (as listed in Table 12-1) are commercially available for use in diagnostic microbiology laboratories, and the four basic identification components outlined in Figure 7-17 are common to them all. However, different systems vary in their approach to each component. The most common variations involve the following: • Types and formats of tests included in the test battery • Method of inoculation or specimen application (manual or automated) • Required length of incubation for substrate utilization; this usually depends on whether utilization requires bacterial growth • Method for detecting substrate utilization and whether detection is manual or automated • Method of interpreting and analyzing results (manual or computer assisted), and if computer assisted, the extent to which assistance is automated The general features of some commercial identification systems are summarized in Table 12-1. More specific information is available from the manufacturers. Visit the Evolve site for a complete list of procedures, review questions, and case study answers.

Bibliography Alatoom AA, Cunningham SA, Ihde SM, et al: Comparison of direct colony method versus extraction method for identification of gram-positive cocci by use of Bruker Biotype matrix-assisted laser desorption ionization-time of flight mass spectrometry, J Clin Microbiol 49:2868, 2011. Bourbeau, PP, Ledeboer NA: Automation in clinical microbiology, J Clin Microbiol 51:1658, 2013. Brink B: Urease test protocol, 2013, American Society for Microbiology. http://www.microbelibrary.org/library/laboratory1test/ 3223-urease-test-protocol. Accessed 6/7/2015. Jorgensen J, Pfaller M, Carroll K, et al: Manual of clinical microbiology, ed 11, Washington, DC, 2015, ASM Press. Saffert RT, Cunnigham SA, Ihde SM, et al: Comparison of Bruker Biotyper Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometer to BD Phoenix Automated Microbiology System for identification of gram-negative bacilli, J Clin Microbiol 49:887, 2011.

8

Nucleic Acid–Based Analytic Methods for Microbial Identification and Characterization O B J E C T I V E S � Explain the importance of molecular testing methods in 1. the microbiology laboratory. List the three categories of molecular testing methods and provide a brief explanation of the methodology for each type. Identify at least three factors affecting nucleic acid sample 2. integrity during collection and transport of a molecular specimen. Construct a flow chart describing the workflow and basic 3. steps involved in a nonamplified nucleic acid hybridization method; include the key reagents or components involved and the products for each step. 4. Repeat the flow chart for an amplified hybridization method as indicated in objective 3. 5. Identify the key differences in a nonamplified and amplified nucleic acid hybridization method. Define the characteristics required to design a nucleic acid 6. hybridization probe for the detection of a specific viral or bacterial strain versus detection of a broad category of microorganism. List at least three different functional types of hybridiza7. tion probe reporter molecules used in nucleic acid–based tests; classify each as either direct or indirect and rank the sensitivity, from lowest to highest, for each type. Predict the melting temperature of a deoxyribonucleic 8. acid (DNA)/DNA hybridized duplex.

T

he principles of bacterial cultivation and identification discussed in Chapter 7 focus on phenotypic methods. These methods use readily observable bacterial traits and phenotypic characteristics to aid in the identification and characterization of bacterial species. Although these strategies are the mainstay of diagnostic bacteriology, notable limitations are associated with the use of phenotypic methods. These limitations include: • � Inability or an extensive delay in cultivation and identification of fastidious or slowly growing bacteria

9. Explain how the melting temperature of a probe or primer would be affected by a single nucleotide mutation on a target nucleic acid sequence. 10. Explain the methodology for peptide nucleic acid fluorescent in situ hybridization (PNA FISH) and provide an example of a clinical application. 11. Compare and contrast the advantages, disadvantages, and outcomes of the three types of nucleic acid extraction techniques. 12. Outline the three major steps in polymerase chain reaction (PCR) and describe the critical parameters of each step, including reagents, temperature, time, and interfering substances. 13. Define reverse transcription polymerase chain reaction (RT-PCR);explain how and why it is used and the methodology that differentiates it from a traditional PCR test. 14. Explain real-time PCR and list the four potential advantages this procedure has over conventional PCR. 15. Describe how restriction endonucleases are used in epidemiologic applications and strain typing in molecular diagnostics. 16. Define pulsed-field gel electrophoresis (PFGE) and restriction fragment length polymorphism (RFLP) and state an application for each.

• � Inability to maintain viability of certain pathogens during transport of specimens to the laboratory • � Lack of reliable and specific methods to identify certain organisms grown in vitro • � Use of considerable time and other resources to identify and confirm the presence of pathogens in specimens using culture-based methods Molecular methods used to identify organisms in the diagnostic microbiology laboratory offer alternatives to the culture-based, phenotypic strategies discussed in Chapter 7 113

114 PA RT I I

General Principles in Clinical Microbiology

and have evolved to overcome several of the aforementioned limitations. Molecular methods involve the detection and manipulation of nucleic acids (deoxyribonucleic acid [DNA] and ribonucleic acid [RNA]), allowing microbial genes to be examined directly (i.e., genotypic methods) rather than by analysis of their products, such as enzymes, other proteins, and toxins, or identifiable characteristics of organism growth (i.e., phenotypic methods). Because nucleic acids are essential for the viability of all infectious agents, molecular methods are adaptable for the diagnosis of viral, fungal, parasitic, and bacterial infections. Application of molecular diagnostics in microbiology provide for the qualitative and quantitative detection of pathogenic organisms in patient specimens, microbial identity testing after culture, negative validation testing, and genotyping for antimicrobial drug resistance. In the past decade, the use of molecular testing in the clinical laboratory has dramatically expanded with the availability of lower cost instrumentation, automated systems that enable high-throughput testing, and an increasing menu of commercially available reagents and kits for pathogen detection. As technologies continue to evolve, it is anticipated that molecular techniques will continue to replace many of the phenotypic methods once widely used in the clinical laboratory and become a mainstay in the detection and diagnosis of infectious diseases. This chapter discusses the general principles, techniques, and applications of molecular diagnostics in the clinical laboratory. It is intended to be an overview; additional methods are included in upcoming chapters.

Overview of Nucleic Acid–Based Methods Molecular diagnostic tests are based on the consistent and somewhat predictable nature of DNA and RNA. Therefore a basic knowledge regarding the structure of nucleic acids and their composition is essential for understanding nucleic acid based methods. Therefore a review of the section Nucleic Acid Structure and Organization in Chapter 2 is recommended. The nucleic acid–based methods included in this chapter are classified into one of three categories: (1) hybridization, (2) amplification, and (3) sequencing and enzymatic digestion of nucleic acids. Considerations for specimen collection, transport, and initial processing before nucleic acid–based testing is also discussed.

Specimen Collection and Transport Proper specimen collection, transport, and processing are essential in all areas of the diagnostic laboratory to ensure accurate results. Nucleic acids for molecular testing can be isolated from bacterial, parasitic, viral, and fungal pathogens found in a wide variety of specimen types from virtually any anatomic site, such as blood, urine, sputum, swabs, and tissues. The quality and quantity of the specimen is essential to obtaining an accurate result in molecular diagnostics.

Unlike traditional culture, nucleic acid–based testing does not always require the detection of viable or infectious organisms. However, maintaining the integrity of the nucleic acids within the sample is of utmost importance, because DNA and RNA are inherently sensitive to degradation by endogenous nucleases present in specimens. Factors that may affect the integrity of the sample include specimen type, specimen collection device, timing of collection and transport, and storage conditions. For example, plastic swabs are recommended for collection of bacteria, viruses, and mycoplasmas from mucosal membranes. The organisms are more easily removed from the plastic shafts than from other materials such as wooden shafts or wire. This provides an increase in nucleic acid yield, thereby increasing analytical sensitivity of the molecular test. In addition, calcium alginate swabs with aluminum shafts have been reported to interfere with the amplification of nucleic acids. Most molecular test kits include transport containers that contain liquid fixatives, nuclease inhibitors, and/or lysing agents to improve nucleic acid isolation and improve yield from specimens that contain cellular debris or other contaminants. In molecular diagnostics, it is essential that the specimen be collected and stored in the recommended container or medium as indicated by the manufacturer of each individual assay.

Nucleic Acid Hybridization Methods Hybridization methods are based on the ability of two nucleic acid strands with complementary base sequences (i.e., they are homologous) to bond specifically with each other and form a double-stranded molecule, also called a duplex or hybrid. This duplex formation is driven by the hydrophobic structure and hydrogen bonding pattern of the nucleotides, which ensure that, in DNA, the base adenine always bonds to thymine (two hydrogen bonds), whereas the bases guanine and cytosine (three hydrogen bonds) always form a bonding pair (Figure 2-2). In RNA, the same base pairing rules follow for guanine and cytosine, but uracil replaces thymine to form a base pair with adenine. To identify the presence of an organism suspected of causing disease, hybridization assays involve duplex formation between two nucleic acid strands; one strand (the probe) consists of a short, reporter-labeled nucleic acid molecule that is complementary to a nucleic acid target of a suspected pathogen. This carefully designed and presynthesized probe is mixed with nucleic acids purified from the patient specimen (target nucleic acids). If nucleic acids from the suspected pathogen are present in the patient specimen, a DNA duplex will form between the probe and target molecule, resulting in a positive hybridization signal (Figure 8-1). Because similarities between base sequences in DNA are an indication of evolutionary relationships among organisms (i.e., homology), positive hybridization identifies the unknown organism as being the same as the probesource organism or closely related sequence. A negative hybridization test result indicates that the organism being

CHAPTER 8 Nucleic Acid–Based Analytic Methods for Microbial Identification and Characterization

115

Reportermolecule PROBE(single­stranded nucleicacidprobefrom knownsequence)

A A A G G G G

T T T C C C C

C C G T A C G

Sequence complementary (homologous)with probesequence

Sequencenot complementary (nonhomologous) withprobesequence

CCG Probe target

TARGET(nucleic acidstrands fromunknown organism)

G T AC

GG AAA

GG

Duplexformation (hybridizationpositive)

Noduplexformation

(hybridizationnegative)

Unknownorganism identified or detected

Unknownorganism

notidentified

or

detected

• Figure 8-1 Principles of nucleic acid hybridization. Identification of an unknown organism is established by positive hybridization (i.e., duplex formation) between a nucleic acid strand from the known sequence (i.e., the probe) and a target nucleic acid strand from the organism to be identified. Failure to hybridize indicates lack of homology between the probe and the target nucleic acid.

tested for is either not identifiable or below the limit of detection for the hybridization test. Single-stranded nucleic acid probes may be either RNA or DNA; therefore, DNA-DNA, DNA-RNA, and even RNA-RNA duplexes may form, depending on the specific design of the hybridization assay. Hybridization assays may be classified as either nonamplified or amplified. A nonamplified assay requires four basic steps: selection of a probe, preparation (purification) of the test sample (nucleic acid), hybridization, and signal detection. Amplified assays include an additional step, whereby initial hybridization is followed by target amplification, and then by signal detection. As such, amplified assays are inherently more sensitive than nonamplified assays and, when optimized, can detect as few as one copy of a specific nucleic acid sequence in the specimen.

Hybridization Steps and Components The basic steps in a hybridization assay include: 1. Production and labeling of single-stranded nucleic acid probe

2. Preparation of single-stranded target nucleic acid 3. Mixture and hybridization of target and probe nucleic acid 4. Detection of hybridization Production and Labeling of Probe Nucleic Acid

In keeping with the requirement of complementation for hybridization, the probe design (i.e., probe length and the sequence of nucleic acid bases) depends on the sequence of the intended target nucleic acid. Therefore the selection and design of a probe depends on the intended use. For example, if a probe is to be used to recognize only gram-positive bacteria, its nucleic acid sequence must be complementary to a nucleic acid sequence common only to gram-positive bacteria and not to gram-negative bacteria. Nucleic acid probes can be designed to identify a particular bacterial genus or species, a virulence factor, or an antibiotic-resistance gene present within the genome of a given species. In the past, probes were produced through a laborintensive process involving recombinant DNA and cloning techniques with the nucleic acid sequence of interest. DNA and RNA probes are now chemically synthesized with

116 PA RT I I

General Principles in Clinical Microbiology

extremely high-fidelity using specialized instrumentation. The base sequence of potential target genes, sequence patterns, or gene fragments for probe design are easily accessed using online sequence databases (e.g., GENBANK, National Center for Biological Information). Although probes may be hundreds to thousands of bases long, oligonucleotide probes (i.e., those 20 to 50 bases long) usually are sufficient for detection of most clinically relevant targets. Other considerations in probe design include stability during storage (i.e., shelf life), formation of secondary structures, melting temperature, and tendency to selfhybridize. In short, the design and production of nucleic acid probes is relatively easy but remains critical to the overall success and accuracy of nucleic acid–based assays. In addition to probe design, all hybridization tests must have a means to detect or measure the hybridization reaction, either directly or indirectly. This is accomplished with the use of a reporter molecule attached directly to the single-stranded nucleic acid probe. Probes may be labeled with a variety of reporter molecules, including radioactive isotopes (e.g., 32P, 3H, 125I, or 35S), biotin-avidin, digoxigenin, a variety of fluorescent molecules, or chemiluminescent compounds (Figure 8-2). Radioactive labels are directly incorporated into the nucleic acid molecules during probe synthesis. With the use of

Radioactivereporter andautoradiography

radioactively labeled probes, hybridization is detected by the emission of radioactivity from the probe-target complex (Figure 8-2, A). Quantification of the complexes may be achieved through scintillation counting or densitometry. Although this is a highly sensitive method for detecting hybridization, the requirements for radioactive training, monitoring, licensing, and disposal of radioactive waste have limited the use of radioactive labeling in the diagnostic setting. Nonradioactive alternatives for labeling nucleic acid probes involve the covalent attachment of a reporter molecule to the probe using a chemical coupling reaction. Attachment of biotin (i.e., “biotinylation”) enables the detection of target-probe duplexes using a biotin-binding protein, avidin, which is conjugated to an enzyme, such as horseradish peroxidase. When a chromogenic substrate is added, the enzyme catalyzes a chemical reaction, producing a colored product that can be detected visually or spectrophotometrically (Figure 8-2, B). Biotin labels are classified as indirect because of the requirement for a secondary biotinavidin–enzyme complex formation for detection. Variations on this indirect enzyme-based detection scheme include the use of digoxigenin-labeled probes, in which hybridization is detected using antidigoxigenin antibodies

Biotin­avidinreporter andcolorimetricdetection

32

P­labeled probe

Biotin­ labeledprobe

Target nucleicacid

Target nucleicacid

Chemiluminescentreporter anddetectionofemittedlight Acridinium­ labeled probe Target nucleicacid

Hybridized duplex

Hybridization duplex

Hybridized duplex labeledwith acridinium

+ Avidin­ enzyme complex

X­rayfilmplaced incontactwith labeledduplex

+

Biotin­avidin enzyme complex withduplex Chromogenic substratefor enzyme Enzymatic hydrolysis ofsubstrate

Developedfilm,positive hybridizationindicated byblackareasonfilm resultingfromradioactivity emittedfromradiolabeled probeboundtotarget

A

Positivehybridization detectedbycapturing emissionoflight

B

Positivehybridization detectedbyvisualization ofcolor

C

• Figure 8-2 A, Reporter molecule labeling of nucleic acid probes and principles of hybridization detection. Use of probes labeled with a radioactive reporter, with hybridization detected by autoradiography. B, Probes labeled with a biotin-avidin reporter, with hybridization detected by a colorimetric assay. C, Probes labeled with a chemiluminescent reporter (i.e., acridinium), with hybridization detected by a luminometer to detect emitted light.

CHAPTER 8 Nucleic Acid–Based Analytic Methods for Microbial Identification and Characterization

conjugated to an enzyme. Successful duplex formation means the enzyme is present; therefore, with the addition of a chromogenic substrate a color change or development is interpreted as positive hybridization. More recently, fluorescent and chemiluminescent reporter molecules have become widely used in molecular diagnostics rather than enzyme-based reporters. Chemiluminescent reporter molecules can be chemically linked directly (i.e., direct detection) to the nucleic acid probe without using a conjugated protein or antibody. These molecules (e.g., acridinium or isoluminol) emit light during hybridization between the chemiluminescent-labeled probe and target nucleic acid. The light is detected using a luminometer (Figure 8-2, C ). Fluorescent labels and fluorometric reporter groups (e.g., fluorescein and rhodamine) are also considered direct nucleic acid probes and are available in a range of wavelengths and colors. This has enabled the detection of multiple nucleic acid targets using a cocktail of probes, each attached to a different fluorophore. This process, known as multiplexing, thereby increases the number of pathogens that can be detected simultaneously in a single reaction. Preparation of Target Nucleic Acid

Because hybridization is dependent on complementary binding of a homologous nucleic acid sequence between the probe and target, the target nucleic acid must be present as a single strand and the base sequence integrity must be maintained. Failure to meet these requirements results in negative hybridization reactions as a result of factors such as target degradation, insufficient target yield, and the presence of interfering substances such as organic chemicals (i.e., false-negative results). Because the relatively rigorous procedures for releasing nucleic acid from the target microorganism can be deleterious to the molecule’s structure, obtaining the target nucleic acid and maintaining its appropriate conformation and sequence can be difficult. The steps in target preparation vary, depending on the organism source of the nucleic acid and the nature of the environment from which the target organism is being prepared (laboratory culture media; fresh clinical material, such as fluid, tissue, stool; fixed or preserved clinical material). Generally, target preparation steps involve enzymatic and/or chemical destruction of the microbial envelope to release target nucleic acid, the removal of contaminating molecules such as cellular components (protein), stabilization of the target nucleic acid to preserve structural integrity, and, if the target is DNA, denaturation to a single strand, which is necessary for binding the complementary nucleic acid. Nucleic acid extraction procedures are optimized to ensure a high degree of purity, integrity, and yield of the desired nucleic acid. Nucleic acid extractions may be classified as organic or nonorganic extractions. Organic extractions use phenol, chloroform, or isoamyl alcohol to disrupt the cellular membranes and denature and remove proteins. After chemical treatment with the organic solution, the mixture is centrifuged, which results in the separation or phasing of the

117

cellular material layered over the top of the organic molecules and waste along the bottom of the tube. The aqueous phase, containing the desired nucleic acid, is then extracted from the organic phase, and the resulting nucleic acid is precipitated using a buffered solution. Nonorganic extractions rely on protein precipitations and nucleic acid precipitations without the use of organic chemicals. Cell membranes and proteins are denatured with a detergent, and the proteins are precipitated with a salt solution. Nonorganic extractions are primarily used in clinical laboratories because they are fast, are easy, and do not require the disposal of hazardous organic materials. DNA isolation is not as technically demanding as RNA extraction methods. RNA may be degraded rapidly by the presence of RNase enzymes. RNase enzymes are very stable, ubiquitous in the environment, and elevated in certain tissues, such as the placenta, liver, and some tumors. The inadvertent introduction of RNase enzymes into specimens during RNA purification will result in low or no RNA yield and render the molecular test invalid. To minimize RNA degradation, a dedicated laboratory section is required for RNA manipulation. In addition, RNase-free reagents, water, pipette tips, etc., must be used. Guanidinium isothiocyanate may be used to denature and inactivate RNase enzymes to preserve nucleic acid samples. Two primary physical methods are available for nucleic acid extraction: liquid-phase extraction, as previously described using organic or inorganic reagents, and solidphase extraction. Solid-phase extractions use solid support columns constructed of fibrous or silica matrices, magnetic beads, or chelating agents to bind the nucleic acids. After impurities are removed, the nucleic acids are chemically released and recovered for analysis or amplification. Solid-phase extractions are typically simpler than liquid-phase extractions, requiring less sample volume and providing for ease of operation, processing of large batches, high reproducibility, and adaptability to automation. Mixture and Hybridization of Target and Probe

Designs for mixing target and probe nucleic acids are discussed later, but some general concepts regarding the hybridization reaction require consideration. The ability of the probe to bind the correct target depends on the extent of base sequence identity between the two nucleic acid strands and the environment in which the probe and target are brought together. Environmental conditions set the stringency for a hybridization reaction, and the degree of stringency can determine the outcome of the reaction. Hybridization stringency is most affected by: • � Salt concentration in the hybridization buffer (stringency increases as salt concentration decreases) • � Temperature (stringency increases as temperature increases) • � Concentration of destabilizing agents (stringency increases with increasing concentrations of formamide or urea)

118 PA RT I I

General Principles in Clinical Microbiology

With greater stringency, a higher degree of base-pair complementarity is required between the probe and target to obtain successful hybridization (i.e., less tolerance for deviations in base sequence). Under less stringent conditions, strands with less base-pair complementarity (i.e., strands with a higher number of mismatched base pairs within the sequence) may still hybridize. Therefore as stringency increases, the specificity of hybridization increases, and as stringency decreases, specificity decreases. For example, under high stringency a probe specific for a target sequence in Streptococcus pneumoniae may only bind to the target prepared from this species (high specificity), but under low stringency the same probe may also bind to targets from closely related streptococcal species (lower specificity). Therefore to ensure accuracy in hybridization, reaction conditions must be carefully controlled.

A

Probeandtargetnucleic

acidsmixedinsolution

Reporter­labeled probenucleicacid Targetnucleicacid

B

Hybridization

Duplexes

Unbound,labeledprobe

Detection of Hybridization

The method of detecting hybridization depends on the reporter molecule used for labeling the probe nucleic acid and on the hybridization format (Figure 8-2). Hybridization using radioactively labeled probes is visualized after the reaction mixture is exposed to radiographic film (i.e., autoradiography). Hybridization with nonradioactively labeled probes are detected using colorimetry, fluorescence, or chemiluminescence, and detection can be automated using spectrophotometers, fluorometers, or luminometers, respectively. The more commonly used nonradioactive detection systems (e.g., digoxigenin, chemiluminescence, fluorescence) are able to detect approximately 104 target nucleic acid sequences per hybridization reaction.

Hybridization Formats Hybridization reactions can be done using either a liquid or solid support format. Liquid Format

In the liquid format, probe and target nucleotide strands are placed in a liquid reaction mixture that facilitates duplex formation; hybridization occurs substantially faster than with a solid support format. However, before duplex formation can be detected, the hybridized labeled probes must be separated from the nonhybridized labeled probes (i.e., “background noise”). Separation methods include enzymatic digestion (e.g., S1 nuclease) of single-stranded probes and precipitation of hybridized duplexes, use of hydroxyapatite or charged magnetic microparticles that preferentially bind duplexes, or chemical destruction of the reporter molecule (e.g., acridinium dye) attached to the nonhybridized probe nucleic acid. After the duplexes have been “purified” from the reaction mixture and the background noise minimized, hybridization detection can proceed by the method appropriate for the type of reporter molecule used to label the probe (Figure 8-3). Solid Support Format

Either the probe or target nucleic acids may be attached to a solid support matrix and still be capable of forming duplexes

C

Separationprocesstoremove

unbound,labeledprobes

D

Purifiedduplexesreadfordetection

ofreportermolecule

Purifiedduplexes readyfordetection ofreportermolecule

• Figure 8-3 Principle of the solution hybridization format.

with complementary strands. Various solid support materials and common solid formats exist, including filter hybridizations, southern or northern hybridizations, sandwich hybridizations, and in situ hybridizations. Filter (membrane) hybridization has several variations. Filter hybridizations are often referred to as “dot blots.” The target sample, which can be previously purified DNA, the microorganism containing the target DNA, or the clinical specimen containing the microorganism of interest, is affixed to a membrane (e.g., nitrocellulose or nylon fiber filters). To identify specimens, samples are usually oriented on the membrane using a template or grid. The membrane is chemically treated, causing release of the target DNA from the microorganism and denaturing the nucleic acid to single strands. The membrane is then submerged in a solution containing the labeled nucleic acid probe and incubated, allowing hybridization to occur. After a series of incubations and washings to remove unbound probe, the membrane is processed for detection of duplexes (Figure 8-4, A). An advantage of this method is that a single membrane can hold several samples for exposure to the same probe. Southern hybridization is another method that uses membranes as the solid support. In this instance the nucleic

CHAPTER 8 Nucleic Acid–Based Analytic Methods for Microbial Identification and Characterization

119

Filterhybridization Targetnucleic acidreleased anddenatured tosinglestrand

A

Washand detectionof reporter molecule

Additionof labeledprobe Hybridization

Single­stranded targetaffixedto membrane

Sampleaffixed tomembrane

Southernhybridization Targetnucleic acidbandsare transferredto membrane Additionof labeledprobe

B

Targetnucleic acidfragments separatedbygel electrophoresis

Sandwichhybridization id ac leic c u n get Tar Solid support Captureprobe

Targetfragments denaturedtosingle strand(notvisible onmembrane)

Hybridization betweentarget andcaptureprobe

Hybridization ofprobewith specifictarget fragment

Target nucleic acid

+

Labeled probe

Captureprobe

Detectionof probe—target fragmentduplex byreporter molecule Target nucleic acid Captureprobe

Hybridizationbetween labeledprobeand targetnucleicacid detectedviasignal producedbyreporter molecule

C

• Figure 8-4 Principle of solid support hybridization formats. A, Filter hybridization. B, Southern hybridization. C, Sandwich hybridization.

acid target is purified from the organisms and digested with specific enzymes to produce several fragments of various sizes (Figure 8-4, B) (also see Enzymatic Digestion and Electrophoresis of Nucleic Acids later in this chapter). The nucleic acid fragments, which carry a net negative charge, are subjected to an electrical field, forcing them to migrate through an agarose gel matrix (i.e., gel electrophoresis). Because fragments of different sizes migrate through the porous agarose at different rates, they can be separated by molecular size. When electrophoresis is complete, the nucleic acid fragments are stained with the fluorescent dye ethidium bromide so that fragment “banding patterns” can be visualized on exposure of the gel to ultraviolet (UV) light. For southern hybridization, the target nucleic acid bands are transferred to a membrane that is submerged in solution, allowing for hybridization of the nucleic acid probe. After hybridization, the southern hybridization membrane is used to detect the specific target nucleic acid fragment using a radiolabeled, fluorescent, or substrate-labeled probe for detection. The complexity, time, and labor intensity of this procedure precludes its common use in the clinical diagnostic laboratory.

With sandwich hybridizations two probes are used. One probe is attached to the solid support, is not labeled, and “captures” the target nucleic acid from the sample to be tested via hybridization. The presence of this duplex is then detected using a labeled second probe that is specific for another portion of the target sequence (Figure 8-4, C ). Sandwiching the target between two probes decreases nonspecific reactions but requires a greater number of processing and washing steps. For such formats, plastic microtiter wells coated with probes have replaced filters as the solid support material, thereby facilitating the use of these multiple-step procedures for testing a relatively large number of specimens. In Situ Hybridization

In situ hybridization (in situ meaning “in place” or “in position”) allows a pathogen to be identified from a specimen using the patient’s cells or tissues as the solid support phase. Tissue specimens thought to be infected with a particular pathogen are processed in a manner that maintains the structural integrity of the tissue and cells, yet allows the nucleic acid of the pathogen to be accessed in situ and denatured to

General Principles in Clinical Microbiology

120 PA RT I I

a single strand with the base sequence intact for hybridization with the pathogen-specific probe. When the probe is attached to a fluorescent molecule, this hybridization technique is known as fluorescence in situ hybridization (FISH). Although the processing steps required to obtain quality results can be technically demanding, this method can be extremely informative, because it combines the power of molecular diagnostics with the additional information provided through histopathologic examination. Peptide Nucleic Acid Fluorescence In Situ Hybridization

A variant of the FISH method replaces standard DNA or RNA nucleic acids with a synthetic peptide nucleic acid (PNA) probe. PNAs are synthetic nucleic acids that have unique chemical characteristics in which the negatively charged sugar-phosphate backbone of DNA is replaced by a neutral polyamide backbone (Figure 8-5). Individual nucleotide bases can be attached to this neutral backbone, which then allows the PNA probe to hybridize with complementary nucleic acid targets according to the standard base pairing rules (A-T/U; C-G). However, because of the synthetic structure of the backbone, PNA probes have improved hybridization characteristics, providing faster and more specific results than traditional DNA probes. In addition, because these probes are not degraded by nucleases and proteases, they provide a longer shelf life in diagnostic applications. An example of in vitro diagnostic PNA FISH assays that are approved by the U.S. Food and Drug Administration (FDA) is one available from AdvanDx (Woburn, MA). These kits can be used to directly identify Staphylococcus aureus, coagulase-negative staphylococci, Pseudomonas aeruginosa, Klebsiella pneumoniae and Candida albicans and to differentiate Enterococcus faecalis from other enterococci in blood cultures. In brief, a drop from a positive blood culture bottle is added to a slide containing a drop of fixative solution. After fixation, the fluorescent-labeled PNA probe is added and allowed to hybridize with purified RNA from a patient specimen; the slides are then washed and air dried. After the addition of a mounting medium and a coverslip, the slides are examined under a fluorescent microscope using a special filter set. Identification is based on the presence of bright green, fluorescent-staining organisms (Figure 8-6, A and B). DNA

B

B O P O ­O O

O HO B

B O P O ­O O

O

B

PNA

O N

O

O

H2N

• Figure 8-5 Peptide

N H

N

O P O O­ O­

O

B O

O N H

N

O N H

nucleic acid (PNA) probes. The structure of DNA is compared with the structure of a synthetic PNA probe; the chemical modification of DNA allows for greater sensitivity and specificity of the PNA probes compared with the DNA probes. (Courtesy of AdvanDx, Woburn, MA.)

For negative results, only slightly red-stained background material is observed (Figure 8-6, C and D). Collectively, these methods have demonstrated high sensitivity and specificity for pathogen detection. Hybridization with Signal Amplification

To increase the sensitivity of hybridization assays, methods have been developed in which detection of the binding of the probe to its specific target is enhanced without amplification of the sequence (i.e., signal amplification). For example, one commercially available kit uses genotype-specific RNA probes in either a high-risk or low-risk cocktail to detect the human papillomavirus (HPV) DNA in clinical specimens (see Chapter 65). Essentially, sensitivity of HPV detection by hybridization is increased by multimeric layering of reporter molecules, increasing their number on an antibody directed toward DNA-RNA hybrids using chemiluminescence; thus, sensitivity of detection is enhanced by virtue of greater signal produced (i.e., chemiluminescence) for each antibody bound to the target. Molecular diagnostic methods that use signal amplification include branched DNA (bDNA), hybrid capture, and cleavase-invader or isothermal (constant temperature) cycling probe technology. In bDNA, a target-specific probe is attached to a substrate such as a microtiter well. The complementary target is then captured by hybridization to the capture probe. In addition, the assay may contain a second set of target-specific probes in solution that will also bind to the target to increase the capture of the target and enhance binding to the anchored probes attached to the substrate. Washing of the complexed target and probes removes any unbound nucleic acids. An amplifier molecule added to the assay will then bind to the targetprobe complexes. The amplifier molecule is designed similar to a tree trunk, with multiple branches extending from the trunk. The multiple branches are then modified with a reporter molecule, such as an enzyme substrate that will emit light after addition of the enzyme, producing a characteristic emission of light that indicates the presence of bound target nucleic acid. Nonspecific hybridization may also occur using bDNA as previously discussed for general hybridization techniques. In bDNA methods, nonspecific hybridization of the probes or nontarget sequences present in the sample may lead to an amplification of the background. Isocytidine (isoC) and isoguanosine (isoG) have been used to reduce background. These chemically altered isomers can be incorporated into the bDNA probes and will base pair with each other, but not with the naturally occurring cytosine and guanosine. This reduces the potential for background signal and increases the detection limits without reducing specificity. Hybrid capture differs from bDNA assays in that the hybridization occurs in solution using nucleic acid–specific probes followed by a bound universal capture antibody. The target nucleic acid is denatured, separating doublestranded DNA molecules. The denatured nucleic acids are then hybridized with a target-specific RNA probe. The DNA-RNA hybrids are then captured with an antihybrid antibody that contains a chemiluminescent reporter

CHAPTER 8 Nucleic Acid–Based Analytic Methods for Microbial Identification and Characterization

A

B

C

D

121

• Figure 8-6 Using a fluorescent-tagged peptide nucleic acid (PNA) probe in conjunction with fluorescent in situ hybridization (FISH), Staphylococcus aureus (A) or Candida albicans (B) can be directly identified in blood cultures. A drop from the positive blood culture bottle is added to a slide containing a drop of fixative solution, which keeps the cells intact. After fixation, the appropriate fluorescent-labeled PNA probe is added. The PNA probe penetrates the microbial cell wall and hybridizes to the ribosomal RNA (rRNA). Slides are examined under a fluorescent microscope. If the specific target is present, bright green, fluorescentstaining organisms are present. Blood cultures negative for either S. aureus (C) or C. albicans (D) by PNA FISH technology are shown for comparison. (Courtesy of AdvanDx, Woburn, MA.)

molecule (i.e., alkaline phosphatase). The light emitted is then measured using a luminometer. A variety of hybrid capture assays are FDA-approved for the detection of Chlamydia trachomatis, Neisseria gonorrhoeae, and HPV (Qiagen, Germantown, MD). Cleavase-invader technology (Hologic, Bedford, MA) uses the enzymatic cleavage of a DNA structure by a specific DNA polymerase referred to as cleavase. The method uses two probes that hybridize to the target sequence. The signal probe hybridizes to the specific target, followed by the invader probe that will dislodge the 5' end of the signal probe. The cleavase then enzymatically removes the free, dangling 5' region of the signal probe. This product then

becomes the invader probe for the subsequent hybridization and detection reaction. This is accomplished using a fluorescent energy transfer (FRET) probe that includes a reporter molecule and a quencher molecule. The specific chemical design of a probe using FRET is discussed in more detail later in this chapter. Basically, the FRET probe is designed so that the two fluorescent molecules, the reporter and quencher, are incorporated into the probe. As long as the probe remains intact, the quencher prevents the release of a high fluorescent signal by the reporter. Once the cleaved product from the first reaction is released, it becomes the invader probe, and the reporter molecule is cleaved from the quencher, resulting in a fluorescent signal. This technology

122 PA RT I I

General Principles in Clinical Microbiology

relies on the hybridization and formation of the initial probe-target duplex for the formation of substrate for the cleavase. Without the formation of the specific hybridization structure, there is no cleaving of the probe and no secondary reaction occurs, indicating the target is not present. Similar to the invader technology, cycling probe technology uses a DNA-RNA combination probe that includes a fluorescent reporter and a quencher molecule. The probe is designed with an RNA sequence in the center of two flanking DNA sequences that contain the reporter and quencher molecules. Using the appropriate denaturing and hybridization conditions, the probe hybridizes to the singlestranded DNA target. Once hybridized, RNase H, a highly specific RNA degrading enzyme that is active only in the presence of DNA-RNA hybrids, cleaves or degrades the RNA portion of the probe. This reaction releases the two flanking DNA regions of the probe, separating the quencher molecule from the reporter molecule and resulting in a fluorescent signal. As the reaction continues, additional probes will bind, become degraded, and the fluorescent signal will increase over time. As with the previous signal-enhancing methods, the presence of the target leads to the formation of a specific structure and activation of the signal, indicating a positive reaction. Target amplification methods, discussed in the next section, may be coupled with signal amplification technologies to improve levels of detection or the level of target in the sample required to obtain a positive signal.

Amplification Methods—Polymerase Chain Reaction–Based Although hybridization methods are highly specific for organism detection and identification, they are limited by their sensitivity; that is, without sufficient target nucleic acid in the reaction, false-negative results can occur. Therefore hybridization methods may require “amplifying” of a target nucleic acid by growing target organisms to greater numbers in culture. The requirement for cultivation detracts from the potential for faster detection and identification of the organism using molecular methods. Therefore the development of molecular amplification techniques that do not rely on organism multiplication has contributed greatly to faster diagnosis and identification while enhancing sensitivity and maintaining specificity. For purposes of discussion, amplification methods are divided into two major categories: methods that use polymerase chain reaction (PCR) technology, and methods that are not PCR-based.

Overview of Polymerase Chain Reaction and Derivations The most widely used target nucleic acid amplification method is the polymerase chain reaction (PCR). This method combines the principles of complementary nucleic acid hybridization with those of nucleic acid replication applied repeatedly through numerous cycles. This method is able to amplify a single copy of a nucleic acid target, often undetectable by standard hybridization methods, to 107 or

more copies in a relatively short period of time. This provides ample target that can be readily detected by several methods. Conventional PCR involves as few as 20 to 50 repetitive cycles, with each cycle comprising three sequential reactions: denaturation of the target nucleic acid, primer annealing to single-stranded target nucleic acid, and extension of the primer-target duplex. Extraction and Denaturation of the Target Nucleic Acid

For PCR, nucleic acid is first extracted (released) from the organism or a clinical sample using heat, chemical, or enzymatic methods. As discussed earlier in this chapter, numerous methods are available to accomplish this task, including a variety of commercially available kits that extract either RNA or DNA, depending on the specific target of interest. Other commercially available kits are designed to extract nucleic acids from specific types of clinical specimens, such as blood or tissues. Most recently, automated instruments employing magnetic beads or other solid-phase extraction methods and fluid dispensing robotics (such as the Roche MagNa Pure 96, Beckman Coulter SPRI-TE nucleic acid extractor, and Qiagen QIAcube) have been introduced to extract nucleic acid from various sources. These automated instruments streamline the molecular diagnostic workflow and increase throughput for many nucleic acid–based tests (Figure 8-7). Once extracted, target nucleic acid is added to the reaction mix containing all the necessary components for PCR (primers, nucleotides, covalent ions, buffer, and enzymes) and placed into a thermal cycler to undergo amplification (Figure 8-8). Before PCR begins, the target nucleic acid must be in the single-stranded conformation so that the

• Figure 8-7 The MagNA Pure LC System has been on the market

since 1999. It is a fully automated nucleic acid extractor, capable of isolating deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and viral nucleic acid from a variety of samples: blood, cells, plasma or serum, or tissue. Based on a magnetic bead technology, it is designed to automate nucleic acid purification and polymerase chain reaction (PCR) set up. The new MagNA Pure LC 2.0 is equipped with an integrated computer, LCD monitor with touch screen, and Laboratory Information Management System (LIMS) network compatibility.

CHAPTER 8 Nucleic Acid–Based Analytic Methods for Microbial Identification and Characterization

123

Cycle1 Targetsequenceofinterest: AGTCCATAGTCCATCCAAAAGTCCATCCA TCAGGTATCAGGTAGGTTTTCAGGTAGGT

1.Denaturationto singlestrands

94°C AGTCCATAGTCCATCCAAAAGTCCATCCA TCAGGTATCAGGTAGGTTTTCAGGTAGGT

2.Primers binding (annealing)

50°­65°C AGTCCATAGTCCATCCAAAAGTCCATCCA TCAGGTAT TCCATCCA TCAGGTATCAGGTAGGTTTTCAGGTAGGT

3.Primerextensionby actionof DNA polymerase

72°C AGTCCATAGTCCATCCAAAAGTCCATCCA TCAGGTATCAGGTAGGTTTTCAG

Extensionof complementary sequences AAAAGTCCATCCA AGTCCATCCA TCAGGTATCAGGTAGGTTTCAGGTAGGT

Cycle2 Repeatsteps 1through3

AGTCCATAGTCCATCCAAAAGTCCATCCA TCAGGTATCAGGTAGGTTTTCAG AGTCCATCCAAAAGTCCATCCA TCAGGTATCAGGTAGGTTTTCAGGTAGGT AGTCCATAGTCCATCCAAAAGTCCATCCA TCAGGTATCAGGTAGGTTTTCAG AGTCCATCC AAAGTCCATCCA TCAGGTATCAGGTAGGTTTTCAGGTAGGT

25­45cyclesresultingin 106­108copiesoftargetsequence

• Figure 8-8 Overview of a polymerase chain reaction. The target sequence is denatured to single strands, primers specific for each target strand sequence are added, and deoxyribonucleic acid (DNA) polymerase catalyzes the addition of deoxynucleotides to extend and produce new strands complementary to each of the target sequence strands (cycle 1). In cycle 2, both double-stranded products of cycle 1 are denatured and subsequently serve as targets for more primer annealing and extension by DNA polymerase. After 25 to 30 cycles, at least 107 copies of target DNA may be produced. (Modified from Ryan KJ, Champoux JJ, Drew WL, et al: Sherris medical microbiology: an introduction to infectious diseases, Norwalk, Conn, 1994, McGraw-Hill.)

second reaction, primer annealing, can occur. Denaturation to a single strand, which is not necessary for RNA targets, is accomplished by heating to 94°C (Figure 8-8). Primer Annealing

Primers are short, single-stranded sequences of nucleic acid (i.e., oligonucleotides usually 20 to 30 nucleotides long) selected to hybridize (anneal) specifically to a particular nucleic acid target, essentially functioning like probes but without the inclusion of a reporter molecule. As noted for hybridization tests, the abundance of available gene sequence data allows for the design of primers specific for a number of microbial pathogens and their virulence or antibiotic resistance genes. Thus primer nucleotide sequence design depends on the intended target, such as unique nucleotide sequences,

genus-specific genes, species-specific genes, genes encoding virulence factors, or antibiotic-resistance genes. Primers are designed in pairs that flank the target sequence of interest (Figure 8-8). When the primer pair is mixed with the denatured target DNA, one primer anneals to a specific site at one end of the target sequence, and the other primer anneals to a specific site at the opposite end of the other, complementary target strand. Usually primers are designed to amplify an internal target nucleic acid sequence ranging between 50 to 1000 base pairs. The annealing process is typically conducted at 50°C to 58°C or higher but is optimized according to the nucleic acid sequences of the primers and the target. The nucleic acid sequence (e.g., composition of A, C, T, and G nucleotides) of the primer determines the melting temperature (Tm) or

124 PA RT I I

General Principles in Clinical Microbiology

annealing temperature in the reaction. The Tm is defined as the temperature at which 50% of the primers, or in a hybridization assay, the probe, are annealed to the specific target sequence. Because of the complementary binding of nucleotides, the melting temperature may be determined for a known nucleotide sequence. The melting temperature is calculated according to a simple formula: 23(A1T)143(G1C) Therefore the Tm of the primers will determine the annealing temperature used for the PCR reaction. Primer pairs should be optimally designed to anneal within 1 to 5 degrees of each other to maintain the specificity of the amplification reaction. Specificity decreases when the annealing temperature is farther away or lower than the actual Tm of the primers. Extension of the Primer-Target Duplex

Once the duplexes have been formed, the annealing of primers to target sequences provides the necessary template format that allows the DNA polymerase to add nucleotides to the 3' terminus (end) of each primer and extend the sequence complementary to the target template (Figure 8-8), mimicking nucleic acid replication and generating a new double-stranded molecule. Taq polymerase, derived from the thermophilic bacteria Thermus aquaticus, is the enzyme commonly used for primer extension, which occurs at 72°C. This enzyme is used because of its ability to function efficiently at elevated temperatures and to withstand the denaturing temperature of 94°C through several amplification cycles. The three reaction steps in PCR occur in the same tube containing the mixture of target nucleic acid, primers, components to optimize polymerase activity (i.e., buffer, cation [MgCl2], and salt), and deoxynucleotides (dNTPs). To minimize the time lag required to alter the reaction temperature between denaturation, annealing, and extension over several cycles, automated programmable thermal cyclers are used. These cyclers hold the reaction vessel and carry the PCR mixture through each reaction step at the precise temperature and for the optimal duration. As shown in Figure 8-8, for each target sequence originally present in the PCR mixture, two double-stranded fragments containing the target sequence are produced after one cycle. At the beginning of the second cycle of PCR, denaturation produces four templates to which the primers will anneal. After extension at the end of the second cycle, there will be four double-stranded fragments containing target nucleic acid. Therefore with completion of each cycle, there is a doubling or logarithmic increase in the concentration of amplified target nucleic acids. Although it is possible to detect one copy of a pathogen’s gene in a sample or patient specimen by PCR technology, detection is dependent on the ability of the primers to locate and anneal to the single target copy, and on optimization of the PCR conditions. Nonetheless, PCR has proven to be a powerful amplification technique to enhance the sensitivity of molecular diagnostic tests.

Detection of Polymerase Chain Reaction Products

The specific PCR amplification product containing the target nucleic acid of interest is referred to as the amplicon. Because PCR produces an amplicon in substantial quantities, any of the basic methods previously described for detecting hybridization can be adopted for detecting specific amplicons. Detection involves using a labeled probe specific for the target sequence in the amplicon. Therefore solution or solid-phase formats may be used with reporter molecules that generate radioactive, colorimetric, fluorometric, or chemiluminescent signals. Probe-based detection of amplicons serves two purposes: it allows visualization of the PCR product, and it provides specificity by ensuring that the amplicon is the target sequence of interest and not the result of nonspecific amplification. When the reliability of PCR for a particular amplicon has been well established, hybridization-based detection may not be necessary; confirming the presence of the correct-size amplicon may be sufficient. This is commonly accomplished by subjecting a portion of the PCR mixture, after amplification, to gel electrophoresis. After electrophoresis, the gel is stained with ethidium bromide to visualize the amplicon and, using molecular weight–size markers, the presence of amplicons of appropriate size (the size of the target sequence amplified depends on the primers selected for PCR) is confirmed (Figure 8-9). Derivations of the Polymerase Chain Reaction Method

The powerful amplification capacity of PCR has prompted the development of several modifications that enhance the utility of this methodology, particularly in the diagnostic setting. Specific examples include multiplex PCR, nested PCR, quantitative PCR, reverse transcription PCR (RT-PCR),

Sizemarkers inbasepairs

ABCD

1353 1078 872 603

310 281 271 234

• Figure 8-9 Use of ethidium bromide–stained agarose gels to deter-

mine the size of polymerase chain reaction (PCR) amplicons for identification. Lane A shows molecular-size markers, with the marker sizes indicated in base pairs. Lanes B, C, and D contain PCR amplicons typical of the enterococcal vancomycin-resistance genes vanA (783 kb), vanB (297 kb), and vanC1 (822 kb), respectively.

CHAPTER 8 Nucleic Acid–Based Analytic Methods for Microbial Identification and Characterization

arbitrary primed PCR, digital PCR, and PCR for nucleotide sequencing. Multiplex PCR is a method by which more than one primer pair is included in the PCR mixture. This approach offers a couple of notable advantages. First, strategies including internal controls for PCR have been developed. For example, one primer pair can be directed at sequences present in all clinically relevant bacteria (i.e., the control or universal primers), and the second primer pair can be directed at a sequence specific for the particular gene of interest (i.e., the test primers). The control amplicon should always be detectable after PCR; absence of the internal control indicates that PCR conditions were not met, and the test must be repeated. When the control amplicon is detected, absence of the test amplicon can be more confidently interpreted to indicate the absence of target nucleic acid in the specimen rather than a failure of the PCR assay (Figure 8-10). Another advantage of multiplex PCR is the ability to search for different targets using one reaction. Primer pairs directed at sequences specific for different organisms or genes can be combined in a single assay, avoiding the use of multiple reaction vessels and minimizing the volume of specimen required. For example, multiplexed PCR assays containing primers to detect viral agents that cause meningitis or encephalitis (e.g., herpes simplex virus, enterovirus, West Nile virus) have been used in a single reaction tube. A limitation of multiplex PCR is that mixing different primers can cause some interference in the amplification process. For example, amplification of a high-copy analyte may utilize a disproportionate amount of the reaction components, and thereby impair or prevent amplification of a low-copy analyte within the same reaction. Optimizing multiplex

Sizemarkers inbasepairs

ABC

1353 1078

872

603

310 281

271

234

Controlamplicon(370bp) MecAgeneamplicon(310bp)

• Figure 8-10 Ethidium bromide–stained gels containing amplicons produced by multiplex PCR. Lane A shows molecular-size markers, with the marker sizes indicated in base pairs. Lanes B and C show amplicons obtained with multiplex PCR consisting of control primers and primers specific for the staphylococcal methicillin-resistance gene mecA. The presence of only the control amplicon (370 bp) in Lane B indicates that PCR was successful, but the strain on which the reaction was performed did not contain mecA. Lane C shows both the control and the mecA (310 bp) amplicons, indicating that the reaction was successful and that the strain tested carries the mecA resistance gene.

125

PCR conditions can be challenging, especially as the number of primer pairs increases within the assay. Nested PCR involves the sequential use of two primer sets. The first set is used to amplify a target sequence. The amplicon obtained is then used as the target sequence for a second amplification using primers internal to those of the first amplicon. The advantage of this approach is extreme sensitivity and confirmed specificity without the need to use probes. Because production of the second amplicon requires the presence of the first amplicon, production of the second amplicon automatically verifies the accuracy of the first amplicon. The problem encountered with nested PCR is that the procedure requires open manipulations of amplified DNA that is readily, albeit inadvertently, aerosolized and capable of contaminating other reaction vials. Arbitrary primed PCR uses short (random) primers not specifically complementary to a particular sequence of a target DNA. Although these primers are not specifically directed, their short sequence (approximately 10 nucleotides) ensures that they randomly anneal to multiple sites in a chromosomal sequence. Upon cycling, the multiple annealing sites result in the amplification of multiple fragments of different sizes. Theoretically, strains with similar nucleotide sequences have similar annealing sites and thus produce amplified fragments (i.e., amplicons) of similar sizes. Therefore by comparing fragment migration patterns after agarose gel electrophoresis, the examiner can judge strains or isolates to be the same, similar, or unrelated. The PCR methods discussed thus far have focused on amplification of a DNA target. Reverse transcription PCR (RT-PCR) amplifies an RNA target. Because many clinically important viruses have genomes composed of RNA rather than DNA (e.g., the human immunodeficiency virus [HIV], hepatitis B virus), the ability to amplify RNA greatly facilitates laboratory-based diagnostic testing for these infectious agents. Reverse transcription includes a unique initial step that requires the use of the enzyme reverse transcriptase to direct the synthesis of DNA from the viral RNA template, usually within 30 minutes. Once the DNA has been produced, routine PCR technology is applied to obtain amplification. Quantitative PCR (qPCR) is an approach that combines the power of PCR for the detection and identification of infectious agents with the ability to quantitate the actual number of targets originally in the clinical specimen. This technology has arguably been the most significant advancement for molecular diagnostics to date, and many FDAapproved infectious diseases detection systems use this methodology. The ability to quantitate “infectious burden” has tremendous implications for understanding the disease state, establishing the prognosis of certain infections, and monitoring the effectiveness of antibiotic or antiviral therapy (for example, quantifying HIV or hepatitis C virus viral loads in patients is critical for evaluating therapeutic efficacy and monitoring disease progression). Digital PCR (dPCR) is a real-time method that is a modification of the traditional PCR. In traditional PCR,

126 PA RT I I

General Principles in Clinical Microbiology

multiple target sequences are amplified in a single-reaction cuvette or well. Digital PCR separates individual nucleic acid samples within a single specimen into separate regions or droplets. Each region or droplet within the sample will either contain no molecule, a single molecule, or a negative or positive reaction. Therefore the quantitation of the amplification is based on counting the regions that contain a positive amplified product. The quantitation is not based on exponential amplification in comparison with the starting quantity of the target and therefore eliminates errors associated with rate of amplification changes that are affected by interfering substances and the use of a standard curve (described in the melting curve analysis in this chapter). Digital PCR provides a possible resolution for the detection of infectious agents or pathogens that are present in very low numbers in biologic samples.

Real-Time Polymerase Chain Reaction Real-time automated instruments (real-time PCR) that combine target nucleic acid amplification with qualitative or quantitative measurement of amplified product are commercially available (Table 8-1). These instruments are noteworthy for four reasons: 1. The instruments combine thermal cycling for target DNA amplification with the ability to detect amplified target with fluorescently labeled probes as the hybrids are formed (i.e., detection of amplicon in real-time). 2. Both amplification and product detection can be accomplished in one reaction vessel without opening the vessel (a “closed system”), the major concern of crosscontamination of samples with amplified products. 3. The instruments are able to measure amplified product (amplicon) as it is made and quantitate the amount of product, thereby determining the number of copies of target in the original specimen. 4. The time required to complete a real-time PCR assay is significantly reduced compared with conventional PCRbased assays, chiefly by monitoring reaction dynamics in real time and thereby eliminating the need for postreaction analyses (e.g., gel electrophoresis). Several instruments (also referred to as platforms) are available for amplification in conjunction with real-time detection of PCR-amplified products (Figure 8-11). Although not an exhaustive list, each instrument has unique features that permit some flexibility, such that a clinical laboratory can fulfill its specific needs in terms of specimen throughput, number of targets simultaneously detected, detection format, and time to results. Nevertheless, all instruments have amplification (i.e., thermal cycling) capability, as well as an excitation or light source, an emission detection source, and a computer interface to selectively monitor the formation of amplified product. As with conventional PCR, nucleic acids must first be extracted from the clinical specimen before real-time amplification. In principle, real-time amplification is accomplished in the same manner as previously described for conventional PCR-based assays in which denaturation of

double-stranded nucleic acid and primer annealing and extension (elongation) are performed in one cycle. However, it is the detection process that discriminates real-time PCR from conventional PCR assays. In real-time PCR assays, accumulation of amplicon is monitored as it is generated using fluorescence that increases as new amplicons are made. Monitoring of amplified target is made possible by the labeling of primers, oligonucleotide probes (oligoprobes) or amplicons with molecules capable of fluorescing (known as fluorophores). These labels produce a change in fluorescent signal intensity that is measured by the instrument after their direct interaction with or hybridization to the amplicon. Currently, a range of fluorescent chemistries are used for amplicon detection; the more commonly used chemistries can be divided into two categories: (1) those that involve the nonspecific binding of a fluorescent dye to double-stranded DNA (e.g., SYBR Green I) and (2) fluorescent oligonucleotide probes that bind specifically to the target of interest. SYBR Green I chemistry is based on the binding of SYBR Green I to a site referred to as the minor groove (where the strand backbones of DNA are closer together on one side of the helix than on the other), which is present in all doublestranded DNA. Once bound, fluorescence of this dye increases more than 100-fold. Therefore as the amount of double-stranded amplicon increases, the fluorescent signal or output increases proportionally and can be measured by the instrument during the elongation stage of amplification. A major disadvantage of this particular means of detection is that the signal cannot discriminate specific versus nonspecific amplified products without additional melting curve analysis, as described in more detail later. The second category of real-time PCR detection chemistries can be further subdivided based upon the type of fluorescent molecules used in the PCR reaction and include (1) hydrolysis and hybridization probes (e.g., TaqMan, and Molecular Beacons), (2) primer probes (Scorpions and Angler), and (3) nucleic acid analog probes (PNAs). The diversity of unique probe chemistries in each of these categories has dramatically increased within the last 10 years, but not all have found their way into the clinical arena. Figure 8-12 highlights some of the most commonly used approaches to detect amplicons in real-time PCR. Hybridization probes, as previously described, are tagged with two light-sensitive molecules (a fluorophore and quencher pair, or two fluorophores) that interact only at very close spatial distances. In the presence of a quencher, which absorbs the excitation energy of the fluorescent dye, sufficient amounts of fluorescence are possible only after cleavage of the probe (hydrolysis probes) or during hybridization of a hairpin oligonucleotide with a stem-loop structure, known as a molecular beacon, to the amplicon (Figure 8-12, A and B). Alternatively, two fluorescent dyes whose excitation and emission spectra overlap can be attached to two oligonucleotides (dual hybridization probes), which both bind to the amplicon, allowing for the fluorescence excitation energy of one dye to be transferred to the second dye, generating a

CHAPTER 8 Nucleic Acid–Based Analytic Methods for Microbial Identification and Characterization

TABLE Examples of Automation and Instrumentation Available for the Molecular Microbiology Research 8-1 and Clinical Laboratory

Instrument

Manufacturer

Comments

Veriti Thermal Cycler

Applied Biosystems; Thermo Fisher Scientific, Waltham, MA

End-point thermal cycler; FDA-approved for IVD use

GeneAmp PCR System 9700

Applied Biosystems; Thermo Fisher Scientific, Waltham, MA

Interchangeable sample block modules for flexibility

7500 Fast System

Applied Biosystems; Thermo Fisher Scientific, Waltham, MA

IVD applications available in certain countries

QuantStudio Systems

Applied Biosystems: Thermo Fisher Scientific, Waltham, MA

TaqMan array and OpenArray; IVD infectious disease testing

CFX Systems

Bio-Rad, Hercules, CA

Various well formats for flexibility

LightCycler Series

Roche Diagnostics, Indianapolis, IN

Real-time PCR platform; low-high throughput range of instruments available; infectious disease testing available

SmartCycler System

Cepheid, Sunnyvale, CA

Real-time platform; expandable to up to 96 independent tests; multiplex capacity

Isothermal Instrument

Illumipro-10

Meridian Bioscience, Inc., Cincinnati, OH

Automated isothermal amplification and detection; reduced hands-on time; approximately 2 minutes FDA approved

Sequencing

3500 Series Genetic Analyzers

Applied Biosystems; Thermo Fisher Scientific, Waltham, MA

CE-IVD labeled

5500W Series Genetic Analysis Systems

Applied Biosystems; Thermo Fisher Scientific, Waltham, MA

Next-generation sequencing for research use only; flow chip design

COBAS Amplicor Analyzer

Roche Diagnostics; Indianapolis, IN

Real-time PCR platform FDA-approved infectious disease testing available

INFINITI Plus Analyzer

AutoGenomics, Vista, CA

Postamplification, microarray closed analytic system

FilmArray

BioFire Diagnostics Inc., Salt Lake City, UT

Respiratory, gastrointestinal, and blood culture identification panel for 201 different infectious agents FDA-cleared Uses multiplex nested PCR, coupled with film-array detection

COBAS 4800 System

Roche Diagnostics; Indianapolis, IN

Automated extraction and real-time PCR platform FDA-approved testing available

COBAS AmpliPrep/ COBAS TaqMan Analyzer

Roche Diagnostics; Indianapolis, IN

Automated extraction and real-time PCR platform FDA-approved testing available Widely used for viral load testing

Panther System

Hologic, Bedford, MA

Fully automated platform with primary tube sampling to detection Endpoint and real-time transcriptionmediated amplification FDA-approved testing available

Verigene System

Nanosphere, Northbrook, IL

Fully integrated microfluidic test cartridge in closed system FDA-cleared blood culture, gastrointestinal, and respiratory assays available

Traditional Thermal Cyclers

Real-Time Instruments

Semi-Automated

Fully Automated

Continued

127

General Principles in Clinical Microbiology

128 PA RT I I

TABLE Examples of Automation and Instrumentation Available for the Molecular Microbiology Research 8-1 and Clinical Laboratory—cont'd

Amplification and Mass Spectrometry

Instrument

Manufacturer

Comments

GeneXpert and GeneXpert Infinity

Cepheid, Sunnyvale, CA

Fully automated, extraction, real-time detection in closed system; fully automated expanded walkaway infinity system

Plex-ID Pathogen Detector

Iridica/Abbott Molecular, Abbott Laboratories, Abbott Park, IL

Stand-alone or integrated system that includes extraction and processing; uses PCR platform and high-resolution DNA mass spectrometry

DNA, Deoxyribonucleic acid; FDA, Federal Food and Drug Administration; PCR, polymerase chain reaction. � Note: This table is intended to provide an overview of the various types of instruments available for nucleic acid-based testing and is not intended to be all inclusive.

Molecular diagnostic instrumentation, technology, and testing platforms are rapidly evolving. �

A

C

B

D • Figure 8-11 Examples of real-time PCR instruments. A, Applied Biosystems. B, iCycler. C, LightCycler.

D, SmartCycler. (A Copyright © 2012 Life Technologies Corporation. Used under permission. www. lifetechnologies.com; B Courtesy Bio-Rad Laboratories, Hercules, CA; D Courtesy Cepheid, Sunnyvale, CA.)

Taqpolymerase R

3’

Probe Q

Targetgene

Beaconprobe

Loop 5’ Stem R

Q

5’

3’

Fluorescenceemission R

Targetgene Fluorescence emission

Q

R

Q

5’

3’ 3’

5’

Targetgene

Targetgene

B

A R2

Probes annealing R1

3’

Light excitation

Targetgene R1 Fluorescence emission + Energy transfer

R1

Blocker

Stem

R2 Fluorescence emission

Probe

R

Q

5’

3’

5’

Q

Q

5’

5’ Targetgene

Scorpionprobe

Loop

R2

3’

C

5’

D

Targetgene

• Figure 8-12 Fluorogenic probes (probes with an attached fluorophore, a fluorescent molecule that can absorb light energy and then be elevated to an excited state and released as fluorescence in the absence of a quencher) commonly used for detection of amplified product in real-time polymerase chain reaction (PCR) assays. A, Hydrolysis probe. In addition to the specific primers for amplification, an oligonucleotide probe with a reporter fluorescent dye (R) and a quencher dye (Q) at its 5’ and 3’ ends, respectively, is added to the reaction mix. During the extension phase, the quencher (the molecule that can accept energy from a fluorophore and then dissipate the energy, resulting in no fluorescence) can quench the reporter fluorescence when the two dyes are close to each other (a). Once amplification occurs and the fluorogenic probe binds to the amplified product, the bound probe is degraded by the 5’-3’ exonuclease activity of Taq polymerase; therefore, quenching is no longer possible, and fluorescence is emitted and then measured (b). B, Molecular beacon. Molecular beacons are hairpin-shaped molecules with an internally quenched fluorophore that fluoresces once the beacon probe binds to the amplified target and the quencher is no longer in proximity to the fluorophore. These probes are designed such that the loop portion of the molecule is a sequence complementary to the target of interest (a). The “stem” portion of the beacon probe is formed by the annealing of complementary arm sequences on the respective ends of the probe sequence. In addition, a fluorescent moiety (R) and a quencher moiety (Q) at opposing ends of the probe are attached (a). The stem portion of the probe keeps the fluorescent and quencher moieties in proximity to one another, quenching the fluorescence of the fluorophore. When it encounters a target molecule with a complementary sequence, the molecular beacon undergoes a spontaneous conformational change that forces the stem apart, thereby causing the fluorophore and quencher to move away from each other and leading to restoration of fluorescence (b). C, Fluorescent resonant energy transfer (FRET) or hybridization probes. Two different hybridization probes are used, one carrying a fluorescent reporter moiety at its 3’ end (designated R1) and the other carrying a fluorescent dye at its 5’ end (designated R2) (a). These two oligonucleotide probes are designed to hybridize to an amplified deoxyribonucleic acid (DNA) target in a head-to-tail arrangement in very close proximity to one another. The first dye (R1) is excited by a filtered light source and emits a fluorescent light at a slightly longer wavelength. Because the two dyes are so close to each other, the energy emitted from R1 excites R2 (attached to the second hybridization probe), which emits fluorescent light at an even longer wavelength (b). This energy transfer is referred to as FRET. Selection of an appropriate detection channel on the instrument allows the intensity of light emitted from R2 to be filtered and measured. (Modified from Mocellin S, Rossi CR, Pilati P, et al: Quantitative real-time PCR: a powerful ally in cancer research, Trends Mol Med 9:189, 2003.) D, Scorpion probe. A scorpion probe consists of a molecular beacon-style hairpin DNA that is directly linked to the 5’ end of the PCR primer through a blocker. The blocker prevents extension of the PCR primer from the 5’ end. After extension of the primer from the 3’ end by DNA polymerase, the loop region of the probe that is complementary to the target DNA sequence is able to hybridize to the newly synthesized DNA, thereby increasing the distance between the fluorophore and quencher pair. The increased distance relieves the quenching effect on the fluorophore, resulting in an increase in fluorescence emission that is detectable by the real-time PCR instrument. (Modified from Maurin M: Real-time PCR as a diagnostic tool for bacterial diseases, Expert Rev Mol Diagn 12:7, 2012.)

General Principles in Clinical Microbiology

fluorescent emission signal that is detected by the qPCR instrument only when the two fluorophores are in close proximity (i.e., bound to their complementary targets located adjacent to each other on the amplicon) (Figure 8-12, C ). This energy transfer between the two fluorescent dyes is known as fluorescent resonance energy transfer (FRET), or Förster resonance energy transfer. In both cases, fluorescence is evident only after a new amplicon is generated, thereby facilitating the monitoring of the progression of the reaction in real time. Other PCR probes consist of a primer-probe construct that is an oligonucleotide that combines the PCR primer and detection probe into a single molecule. One of these primerprobes, known as a scorpion probe, involves attaching the 5' end of the PCR primer directly to a molecular-beacon style probe (Figure 8-12, D). This effectively limits primer extension to the 3' end. After extension, the probe hybridizes to the newly synthesized DNA, releasing the influence of the quencher from the fluorophore and increasing the fluorescence signal. Nearly all of the probe designs can also be synthesized using nucleic acid analogs, such as PNAs, to increase their stability and binding efficiency. Additional information regarding unique real-time PCR detection chemistries is available from Navarro et al., “Real-time PCR detection chemistries” (2015). Introduction of these additional probes increases the specificity of the PCR product. Also, some realtime PCR instruments (e.g., LightCycler; Roche Diagnostics, Indianapolis, IN) can detect multiple targets (multiplex PCR) by using different probes labeled with specific fluorescent dyes, each with a unique emission spectra. Some real-time PCR instruments also have the ability to perform melting curve analysis. This type of analysis of amplified products confirms the origin (i.e., specificity) of the amplified product and/or identifies nonspecific products. Melting curve analysis can be performed with assays using hybridization probes and molecular beacons but not hydrolysis probes, because hydrolysis probes are destroyed during the amplification process. For simplicity, this discussion will be focused on SYBR Green I–based melting curve analyses. The underlying basis of melting curve analysis lies in the ability to denature (i.e., split the strands) the double-stranded DNA amplicon upon heating (referred to as melting or denaturation), thereby eliminating the fluorescence. The melting temperature (Tm), as previously described for primers, is the temperature at which the DNA denatures into two strands (“melts”) and is dependent on the nucleotide composition of the molecule (stretches of double-stranded DNA with more cytosines and guanines require more heat [energy] to break the three hydrogen bonds between these two bases, in contrast to adenine and thymidine base pairing, which has only two hydrogen bonds). Because the Tm of the amplicon is specific for the target sequence, dependent primarily on base composition, amplification products can be confirmed as correct by the melting characteristics or Tm. Of significance, the Tm can also be used to distinguish base pair differences (e.g., genotypes, mutations, or polymorphisms) in target DNA, thus forming the basis for many genetic testing

assays, because base pair mismatches resulting from mutations alter the Tm. In real-time PCR, melting curve analysis is performed once amplification is completed. The temperature of the reaction vessel is lowered to approximately 50 degrees, and the reaction temperature is slowly raised with concomitant measurements of fluorescence at regular intervals. As the amplicon reaches its melting temperature and the DNA strands split apart, the SYBR Green I dye will dissipate from the DNA molecule, resulting in a marked decrease in fluorescent signal. Similar approaches to melting curve analysis are used for hybridization probes and molecular beacons as described in Figure 8-13. Finally, real-time PCR assays also have the ability to quantitate the amount of target in a clinical sample. For quantitative analysis, amplification curves are evaluated. As previously discussed, amplification is monitored either through the fluorescence of double-stranded DNA–specific dyes (e.g., SYBR Green 1) or by sequence-specific probes; thus during amplification, a curve is generated. During 0.050 0.045 0.040 Fluorescence[­d(F2/Back­F1)/dT]

130 PA RT I I

0.035 0.030 0.025 0.020 0.015 0.010 0.005 0 ­0.005

45

50

55

60

65

70

75

Temperature[°C]

• Figure 8-13 Melting curve analyses performed using the LightCycler HSV1/2 Detection Kit. Deoxyribonucleic acid (DNA) was extracted and subjected to real-time polymerase chain reaction (PCR) using the LightCycler to detect the presence of herpes simplex virus (HSV) DNA. After amplification, melting curve analysis was performed in which amplified product was cooled to below 55°C and the temperature then was raised slowly. The Tm is the temperature at which half of the DNA is single stranded and is specific for the sequence of the particular DNA product. The specific melting temperature is determined at 640 nm (channel F2 on the cycler) for the clinical samples and the positive and negative controls. For illustration purposes, melting curve analyses are “overlaid” relative to one another in this Figure for three clinical samples and the HSV-1 and HSV-2 positive or “template” control. The clinical specimens containing HSV-1 DNA (red line) or HSV-2 (green line) result in a melting peak at 54°C or 67°C, respectively (the Tms). The LightCycler positive or template control containing HSV-1 and HSV-2 DNA, displayed as a purple line, shows two peaks at 54°C and 67°C, respectively. The clinical sample that is negative (brown line) for both HSV-1 and HSV-2 shows no peaks.

CHAPTER 8 Nucleic Acid–Based Analytic Methods for Microbial Identification and Characterization

real-time PCR, there are at least three distinct phases for these curves: (1) an initial lag phase in which no amplicon is detected, (2) an exponential phase of amplification, and (3) a plateau phase. The number of targets in the original specimen can be determined with precision when the number of cycles needed for the signal to achieve an arbitrary threshold (the portion of the curve where the signal begins to increase exponentially or logarithmically) is determined. This segment of the real-time PCR cycle is within the linear amplification portion of the reaction where conditions are optimal and fluorescence accumulates in proportion to the amplicon. With most instrument analyses, the value used for quantitative measurement is the PCR cycle number in which the fluorescence reaches a threshold value of 10 times the standard deviation of baseline fluorescence emission; this cycle number is referred to as the threshold cycle (CT), crossing point (CP), or cycle of quantification (CQ) and is inversely proportional to the starting amount of target present in the clinical sample (Mackay, 2004). In other words, this value is the cycle number in which the fluorescent signal rises above background (the threshold value previously defined) and is dependent on the amount of target nucleic acid in the original sample. Thus to quantitate the target in a clinical specimen, a standard curve is generated in which known amounts of target are prepared and then subjected to

real-time PCR, in parallel with the clinical sample containing an unknown amount of target. A standard curve is generated using the CT values for each of the known amounts of target amplified. By taking the CT value of the clinical specimen and extrapolating from the standard curve, the amount of target in the original sample can be determined (Figure 8-14). Quantitative nucleic acid methods are used to monitor response to therapy, detect the development of drug resistance, and predict disease progression. The introduction of commercially available analytespecific reagents (ASRs) followed soon after the introduction of real-time PCR. ASRs represent a new regulatory approach by the FDA in which reagents in this broad category (e.g., antibodies; specific receptor proteins; ligands; oligonucleotides, such as DNA or RNA probes or primers; and many reagents used in in-laboratory developed tests [LDT]) can be used in multiple diagnostic applications. ASR-labeled reagents carry the “For Research Use Only” label, and the manufacturer is prohibited from promoting any applications for these reagents or providing recipes for using the reagents. Because rulings vary on a state-by-state basis, laboratory supervisors should check into Medicare reimbursement before developing and introducing an ASR assay. A laboratory designated as high complexity according to the Clinical Laboratory Improvement Amendment (CLIA) must take full responsibility for developing,

&7RIVWDQGDUG 7KUHVKROG

/RJIOXRUHVFHQFH

/RJIOXRUHVFHQFH

67$1'$5'&859(

&7RIVDPSOH

&\FOHQXPEHU

%

&\FOHQXPEHU

&7

$

&

131

/RJRIWKHFRQFHQWUDWLRQ

• Figure 8-14 Quantitation using real-time polymerase chain reaction (PCR). A, In the example, four samples

containing known amounts of target are amplified by real-time PCR. The inverse log of their fluorescence is plotted against the cycle number and their respective CT is determined; the fewer the number of targets, the greater the CT value. B, Similarly, the clinical specimen is also amplified by real-time PCR, and its CT value is determined. C, The log of the nucleic acid concentration and the respective CT value for each specimen containing a known amount of target or nucleic acid are plotted to generate a standard curve. Knowing the CT value of the clinical specimen allows the concentration of target in the original sample to be determined.

132 PA RT I I

General Principles in Clinical Microbiology

validating, and offering the diagnostic assay using these reagents. This regulation essentially allows for new diagnostic methods to become available more quickly, particularly methods targeted toward smaller patient populations. It is important to note that because good manufacturing practices are mandated, ASRs provide more standardized products for the performance of amplification assays. ASRs are available for a number of organisms, such as herpes simplex virus types I and II, beta-hemolytic group A and B streptococci, methicillin-resistant Staphylococcus aureus (MRSA), Bordetella pertussis, vancomycin-resistant enterococci, hepatitis A virus, and Epstein-Barr virus.

Amplification Methods: Non–Polymerase Chain Reaction–Based Although PCR was developed first and numerous PCRbased assays are available, rapid, sensitive, and specific detection of infectious agents by nucleic acid amplification can be achieved by a number of methods other than PCR. These amplification formats can be divided into two broad categories: those that amplify the signal used to detect the target nucleic acid and those that directly amplify the target nucleic acid but are not PCR based.

Coupled Target and Signal (Probe) Amplification As previously described regarding signal amplification, the Invader technology can also be considered a probe amplification assay. In other words, the amplified product or signal no longer contains the target nucleic acid sequence. Examples of signal amplification methods used in infectious disease diagnostics are listed in Table 8-2. The Invader assay (Hologic, Bedford, MA) is an isothermal system that can be used to amplify DNA or RNA. Invader chemistry has also been incorporated into a new Invader PLUS system that incorporates a PCR reaction followed by an invader reaction, resulting in a combination target amplification followed by a signal amplification to improve the detection of nucleic acid present in low numbers in the initial specimen.

TABLE Examples of Commercially Available Signal 8-2 Amplification Methods

Method

Manufacturer

Branched DNA (bDNA)

Siemens Healthcare Diagnostics, Inc., Tarrytown, NY

Invader® assays

Hologic, Bedford, MA

Signal-mediated amplification of RNA (SMART)

Cytocell Technologies, Ltd, Cambridge, U.K.

Hybrid capture

Qiagen, Germantown, MD

DNA, Deoxyribonucleic acid; RNA, ribonucleic acid.

Isothermal (Constant Temperature) Amplification Many isothermal amplification techniques have been developed to eliminate the need for the rapid heating and cooling cycles found in PCR-based techniques. Loopmediated isothermal amplification (LAMP) uses four primers and proceeds using a constant temperature coupled to a strand displacement reaction. This technology was developed by the Eiken Chemical Company (Tokyo, Japan). In addition to LAMP, other isothermal methods have been developed that also use strand displacement for amplification. Strand displacement requires four primers, two for each strand of the parent double helix. One primer binds downstream of the other. The downstream primer contains a restriction endonuclease site on the 5' tail. DNA polymerase I (exonuclease deficient) extends from both primers and incorporates a modified nucleotide (2'-deoxyadenosine 5'-O-[1-thiotriphosphate]). During the extension, the newly synthesized strand that is extended from the downstream primer is displaced by the new molecule that is being synthesized by the second primer that is upstream or outside of the first primer. A subsequent set of primers is then capable of binding to the new strand, producing additional amplification product. This amplification product is then used in the second stage of the amplification. In the second step of the reaction, the restriction endonuclease nicks the 5' end of the original downstream primer that is incorporated into the displaced strand. The complementary strand cannot be nicked, because the modified nucleotide that has been incorporated into the strand blocks restriction digestion, and the restriction site therefore is inactive. Once the restriction site has been cleaved, a new double-strand region that contains the primer/probe provides for a new cycle of amplification. Additional isothermal amplifications include nucleic acid sequence–based amplification (NASBA) and transcription-mediated amplification (TMA). Both methods are used for the isothermal amplification of RNA and have clinical utility for the amplification of viral RNA, identification of Mycobacterium spp. antibiotic resistance, and detection of bacteria. The assays use a reverse transcriptase (RT) to copy the target RNA into a complementary DNA molecule (cDNA). Either RNase H or a RT molecule with RNase activity degrades the RNA molecule in the RNADNA hybrid. The remaining cDNA molecule is replicated into double-stranded DNA molecules by the DNA polymerase activity of the polymerase (i.e., T7 bacteriophage RNA polymerase). The RT uses a promoter that was incorporated into the cDNA engineered into the primer for the first amplification of the cDNA. The RT then transcribes antisense RNA molecules from the cDNA molecules. The resulting antisense RNA amplicons then continue the cycle for increased amplification of the target sequence. A relatively new helicase-dependent amplification (HDA) method uses DNA helicase, rather than heat, to separate double-stranded DNA molecules to generate singlestranded templates for amplification. Once separated, singlestranded DNA binding proteins stabilize the single strands

CHAPTER 8 Nucleic Acid–Based Analytic Methods for Microbial Identification and Characterization

to allow binding of the PCR primers. DNA polymerase extends the primers, and the newly synthesized DNA duplexes serve as templates for further amplification cycles. HDA reactions are typically performed at 60°C and can be used to amplify targets present in complex matrices, such as crude bacterial lysates or blood. Another isothermal technique, recombinase polymerase amplification (RPA), employs the enzyme recombinase to catalyze the hybridization of the PCR primer with its complementary target sequence. This method first requires formation of the primer-recombinase complex, which then scans the dsDNA target looking for a homologous sequence. Once the

sequence is located, the recombinase enzyme facilitates separation of the dsDNA and hybridization of the primer before elongation is completed by DNA polymerase. The newly synthesized strand displaces the old strand and serves as a template for the next amplification cycle. RPA is rapid and sensitive but often suffers from high background signals. Some of the non-PCR-based technologies that have been successfully used to detect infectious agents are included in Table 8-3. As with PCR, these assays are able to amplify DNA and RNA targets; have multiplex capabilities; and may be qualitative or quantitative. To learn more about these alternative target amplification methods, refer to

TABLE Examples of Non–Polymerase Chain Reaction–Based Nucleic Amplification Tests 8-3

Amplification Method

133

Examples of Commercially Available Assays

Additional Comments

Manufacturer/Name

Method Overview

Nucleic acid sequencebased amplification (NASBA)

bioMérieux Inc.: NucliSens technology: nucleic acid release, extraction, NASBA amplification, product detection

1. Isothermal amplification achieved through coordination of three enzymes (avian myeloblastosis, RNase H, T7 RNA polymerase) in conjunction with two oligonucleotide primers specific for the target sequence 2. Amplification based on primer extension and ribonucleic acid (RNA) transcription

NucliSens HIV-1 QT NucliSens CMV pp67 NucliSens EasyQ HIV-1 NucliSens EasyQ enterovirus

1. Can be adapted to real-time format using molecular beacons 2. Can develop in-house assays 3. Automated extraction available (NucliSens extractor) 4. EasyQ System comprises an incubator, analyzer, and a computer

Transcriptionmediated amplification (TMA)

Bayer Inc., Tarrytown, NY: Gen-Probe Hologic/Gen-Probe: Sample processing, amplification, target detection by hybridization protection or dual kinetic assays for Chlamydia trachomatis, and Neisseria gonorrhoeae. Also, ASRs for hepatitis C virus (HCV); Gen-Probe/Chiron Corp.: TMA for screening donated blood products for human immunodeficiency virus type 1 (HIV-1) and HCV

1. Autocatalytic, isothermal amplification using reverse transcriptase and T7 RNA polymerase and 2 primers complementary to the target 2. Exponential extension of RNA (up to 10 billion amplicons within 10 minutes)

Gen-Probe: Human papillomavirus (HPV); Mycobacterium tuberculosis Direct Test; APTIMA Combo 2 for dual detection of Chlamydia trachomatis and N. gonorrhoeae; Trichomonas vaginalis. Bayer ASR reagents for HCV; Gen-Probe/ Chiron: Procleix HIV-1/ HCV

1. Second-generation TMA assays of Gen-Probe better at removing interfering substances • Less labor intensive • Uses target capture after sample lysis using an intermediate capture oligomer • TMA performed directly on captured target 2. Fully Automated Systems PANTHER eliminates batch testing • TGRIS DTS system, 1000 samples in 13.5 hours • Instruments handle specimen processing through amplification and detection Continued

134 PA RT I I

General Principles in Clinical Microbiology

TABLE Examples of Non–Polymerase Chain Reaction–Based Nucleic Amplification Tests—cont'd 8-3

Amplification Method Strand displacement amplification (SDA)

Examples of Commercially Available Assays

Manufacturer/Name

Method Overview

BD ProbeTec ET System: SDA coupled with homogeneous real-time detection

1. Isothermal process in which a singlestranded target is first generated 2. Exponential amplification of target

additional reading and articles authored by Ginocchio (2004) and Yan et al. (2014).

Sequencing and Enzymatic Digestion of Nucleic Acids The nucleotide sequence of a microorganism’s genome is the blueprint for the organism. Therefore molecular methods that elucidate some part of a pathogen’s genomic sequence provide a powerful tool for diagnostic microbiology. Other methods used either independently or in conjunction with hybridization or amplification procedures can provide nucleotide sequence information to detect, identify, and characterize microorganisms. These methods include nucleic acid sequencing, enzymatic digestion, and electrophoresis of nucleic acids.

Nucleic Acid Sequencing Nucleic acid sequencing involves methods that determine the exact nucleotide sequence of a single gene or gene fragment obtained from an organism. Recently whole genome sequencing has become available in large research laboratories for detection of microbial pathogens. Although the technologic details of nucleic acid sequencing is beyond the scope of this text, these techniques have been used in the clinical laboratory for many years and are sure to have a powerful effect for some time to come. To illustrate, nucleotide sequences obtained from a microorganism can be compared with an ever-growing gene sequence database for: • � Identifying microbial pathogens and their subtypes • � Detecting and classifying previously unknown human pathogens • � Determining which specific nucleotide changes resulting from mutations are responsible for antibiotic resistance • � Identifying sequences or gene cassettes that have moved from one organism to another

BD ProbeTec ET System for C. trachomatis and N. gonorrhoeae; panel assays for Mycoplasma pneumoniae, Chlamydophila pneumoniae, and Legionella pneumoniae; Chlamydiaceae: assay that detects C. trachomatis, C. pneumophila, and C. psittaci; D ProbeTec M. tuberculosis Direct

Additional Comments 1. Reagents dried in separate disposable microwell strips 2. All assays have internal control to monitor for inhibition 3. Automated system for sample processing: BD Viper Sample Processor

• � Establishing the genetic relatedness between isolates of the same species • � Analyzing the balance between the human microbiome and pathogen(s) and the role of their interactions in the development and prevention of infectious disease Before the development of rapid and automated methods, DNA sequencing was a laborious task only undertaken in the research setting. However, determining the sequence of nucleotides in a segment of nucleic acid from an infectious agent can be accomplished rapidly using an amplified target from the organism and an automated DNA sequencing instrument. Because sequence information can now be rapidly produced, DNA sequencing has entered the arena of diagnostic microbiology. Identification of microorganisms using PCR in conjunction with automated sequencing is slowly making its way into clinical microbiology laboratories. It is becoming quite clear that combinations of phenotypic and genotypic characterization are most successful in identifying a variety of microorganisms for which identification is difficult, such as the speciation of Nocardia, mycobacteria, and organisms that commercial automated instruments fail to identify or correctly identify. Recently Applied Biosystems (Thermo Fisher Scientific, Waltham, MA) has introduced MicroSeq kit-based reagents in conjunction with automated sequencing that allows analysis of a sequence of either the bacterial 16S rRNA gene or the D2 expansion segment region of the nuclear largesubunit rRNA gene of fungi. Of significance, the MicroSeq sequence libraries contain accurate and rigorously verified sequence data; an important component for successful sequencing in the identification of organisms is an accurate and complete sequence database. In addition, the ability to create customized libraries for specific sequences of interest is possible by the availability of flexible software.

CHAPTER 8 Nucleic Acid–Based Analytic Methods for Microbial Identification and Characterization

Postamplification and Traditional Analysis Nucleic Acid Electrophoresis Traditional gel electrophoresis uses an electric current, a buffer, and a porous matrix of agarose or polyacrylamide to separate nucleic acid molecules according to size. As the electric current is applied to the system, the negatively charged nucleic acids will migrate through the gel matrix toward the positive pole or anode within the chamber. Electrophoresis may use a horizontal or vertical gel apparatus or a small tube or capillary system. Capillary electrophoresis uses a thin glass silica capillary tube for faster separation and detection using fluorescent detection. Agarose is a polysaccharide polymer that is extracted from seaweed. It is relatively inexpensive and easy to use. Polyacrylamide is typically a mixture of acrylamide and a cross-linking methylenebisacrylamide. Polyacrylamide is a more porous or highly cross-linked gel that provides for a higher resolution of smaller fragments and single-stranded molecules. Despite the benefit of the higher resolving power of acrylamide gels, in the powder form and unpolymerized form, acrylamide is neurotoxic, and proper safety precautions should be used during handling. In addition to varying systems and matrices, different buffers may be used for the separation of nucleic acids. The two most common buffering systems include Tris acetate or Tris borate buffers. Tris borate ethylenediaminetetraacetic acid (EDTA) (TBE, 0.089 M Tris-base, 0.089 boric acid, 0.0020 M EDTA) has a greater buffering capacity. However, TBE has a tendency to precipitate during storage and generates heat during electrophoresis. Excessive heating during electrophoresis can result in distorted patterns and make detection or interpretation of migration patterns difficult. Tris acetate EDTA (TAE, 0.04 M Tris-base, 0.005 M sodium acetate, 0.002 M EDTA) provides for faster migration or separation during electrophoresis. Denaturing agents such as detergents, formamide, or urea may be added to the buffers that break hydrogen bonds between the complementary sequences on DNA or RNA molecules that may alter migration patterns.

Pyrosequencing Traditional nucleic acid sequencing is based on chain termination and the addition of a labeled nucleotide (TTP, GTP, ATP, CTP, or UTP) that is then detected using a radiolabeled or fluorescent tag. Pyrosequencing is a newer method that incorporates a luminescent signal (generation of a pyrophosphate) when nucleotides are added to the growing nucleic acid strand. The reaction incorporates a sequencing primer that hybridizes to the single-stranded target. The hybrids are incubated with DNA polymerase, ATP sulfurylase, luciferase, and apyrase along with the substrates adenosine-5'-phosphosulfate and luciferin. A single dNTP (deoxynucleotide triphosphate) is added to the reaction. As the polymerase extends the target from the primer, the dNTP is incorporated, releasing a pyrophosphate (PPi). The ATP sulfurylase then converts

135

the PPi to ATP, which drives the conversion of luciferin to oxyluciferin, generating light. The amount of light generated is proportional to the amount of the specific nucleotide incorporated, generating a report or pyrogram. The apyrase degrades the ATP and unincorporated dNTPs, turning off the light and regenerating the reaction mixture. The next dNTP is added, repeating the process for each subsequent nucleotide. Pyrosequencing is useful for identifying drug-resistant mutations and for identification of viral, bacterial, or fungal nucleic acids.

High-Density Deoxyribonucleic Acid (DNA) Probes An alternative to gel-based sequencing has been the introduction of the high-density oligonucleotide probe array. This technology was developed by Affymetrix, Inc. (Santa Clara, CA). The method relies on the hybridization of a fluorescent-labeled nucleic acid target to large sets of oligonucleotides synthesized at precise locations on a miniaturized glass substrate that may include glass or siliconized wafer, referred to as a “chip.” The hybridization pattern of the probe to the various oligonucleotides is then used to gain primary structure information about the target (Figure 8-15). Hybridization high-density microarrays in combination with sequence-independent amplification (PCR) have also been used to identify pathogens. This technology has been applied to a broad range of nucleic acid sequence analysis problems, including pathogen identification and classification, polymorphism detection, and drug-resistant mutations for viruses (e.g., HIV) and bacteria.

Low- to Moderate-Density Arrays Improved technology in molecular diagnostics has resulted in the development of low- to moderate-density microarray platforms that are less expensive than high-density arrays. This has allowed many laboratories to incorporate this new and powerful technology into the daily operations of the diagnostic microbiology laboratory. These microarrays use layered film, gold-plated electrodes, and electrochemical detection or gold-nanoparticles for the detection of target sequences. There are currently several FDA-approved platforms available in the United States that include the INFINITI analyzer (AutoGenomics, Inc., Vista, CA), the eSensor XT-8 system (GenMark Diagnostics, Carlsbad, CA), the FilmArray system (BioFire Diagnostics, Salt Lake City, UT) and the Verigene system (Nanosphere Inc., Northbrook, IL). These instruments are closed-systems and user-friendly, making the detection of nucleic acids relatively simple and free from the hazards of contamination by other circulating nucleic acids or amplification products.

Enzymatic Digestion and Electrophoresis of Nucleic Acids Enzymatic digestion and electrophoresis of DNA fragments are not as specific as sequencing or specific amplification assays in identifying and characterizing microorganisms. However, enzyme digestion–electrophoresis procedures still

General Principles in Clinical Microbiology

136 PA RT I I

Nucleicacidobtainedbyextracting chromosomalorplasmidDNAfrom bacterialculture,orbyPCR amplificationoftargetnucleicacid

Restrictionenzymaticdigestion byendonuclease Example:EcoR1endonucleasedigestion palindrome

cut C–T–T– A– A–G–5’

5’

G–A–A– T–T–C–3’ cut DNArecognition–site

3’

A

Gelelectrophoresistoseparate DNAdigestionfragments

Restriction pattern

• Figure 8-16 Deoxyribonucleic acid (DNA) enzymatic digestion and B • Figure 8-15 Overview of high-density deoxyribonucleic acid (DNA) probes. High-density oligonucleotide arrays are created using lightdirected chemical synthesis that combines photolithography and solidphase chemical synthesis. Because of this sophisticated process, more than 500 to as many as 1 million different oligonucleotide probes may be formed on a chip; an array is shown in A. Nucleic acid is extracted from a sample and then hybridized within seconds to the probe array in a GeneChip Fluidics Station. The hybridized array (B) is scanned using a laser confocal fluorescent microscope that looks at each site (i.e., probe) on the chip, and the intensity of hybridization is analyzed using imaging processing software.

provide valuable information for the diagnosis and control of infectious diseases. Enzymatic digestion of DNA is accomplished using any of a number of enzymes known as restriction endonucleases. Each specific endonuclease recognizes a specific nucleotide sequence (usually 4 to 8 nucleotides in length), known as the enzyme’s recognition or restriction site. Restriction sites are often palindromic sequences; in other words, the two strands have the same sequence, which run antiparallel to one another. Once the recognition site has been located, the enzyme catalyzes the digestion of the nucleic acid strand at that site, causing a break, or cut, in the nucleic acid strand (Figure 8-16). The number and size of fragments produced by enzymatic digestion depend on the length of nucleic acid being digested (the longer the strand, the greater the likelihood of more recognition sites and thus more fragments), the nucleotide sequence of the strand being digested (which dictates the number and location of restriction sites), and the particular enzyme used for digestion. For example, enzymatic

gel electrophoresis to separate DNA fragments resulting from the digestion. An example of a nucleic acid recognition site and enzymatic cut produced by EcoR1, a commonly used endonuclease, is shown in the inset.

digestion of a bacterial plasmid whose nucleotide sequence provides several recognition sites for endonuclease A, but only rare sites for endonuclease B, will produce more fragments with endonuclease A. In addition, the size of the fragments produced will depend on the number of nucleotides between each of endonuclease A’s recognition sites present on the nucleic acid being digested. The DNA used for digestion is obtained by various methods. A target sequence may be obtained by amplification via PCR, in which case the length of the DNA to be digested is relatively short (e.g., 50 to 1000 bases). Alternatively, specific procedures may be used to cultivate the organism of interest to large numbers (e.g., 1010 bacterial cells) from which plasmid DNA, chromosomal DNA, or total cellular DNA may be isolated and purified for endonuclease digestion. After digestion, fragments are subjected to agarose gel electrophoresis, which allows them to be separated according to their size differences as previously described for Southern hybridization (Figure 8-4, B). During electrophoresis, all nucleic acid fragments of the same size comigrate as a single band. For many digestions, electrophoresis results in the separation of several different fragment sizes (Figure 8-17). The nucleic acid bands in the agarose gel are stained with the fluorescent dye ethidium bromide, which allows them to be visualized on exposure to UV light. Stained gels are analyzed by comparing the banding patterns present and photographing them to retain a permanent record of the results (Figures 8-17 to 8-19).

CHAPTER 8 Nucleic Acid–Based Analytic Methods for Microbial Identification and Characterization

ABCDEFG

137

ABCDEF

• Figure 8-18 Although antimicrobial susceptibility profiles indicated that several methicillin-resistant Staphylococcus aureus isolates were the same strain, restriction fragment length polymorphism analysis using pulsed-field gel electrophoresis (Lanes A through F) demonstrates that only isolates B and C were the same.

• Figure 8-17 Restriction

fragment length polymorphisms of vancomycin-resistant Enterococcus faecalis isolates in Lanes A through G as determined by pulsed-field gel electrophoresis. All isolates appear to be the same strain.

One variation of this method, known as ribotyping, involves enzymatic digestion of chromosomal DNA followed by Southern hybridization using probes for genes that encode ribosomal RNA. Because all bacteria contain ribosomal genes, a hybridization pattern will be obtained with almost any isolate, but the pattern will vary depending on the arrangement of genes in a particular strain or organism’s genome. Regardless of the method, the process by which enzyme digestion patterns are analyzed is referred to as restriction enzyme analysis (REA). The patterns obtained after gel electrophoresis are referred to as restriction patterns, and differences between microorganism restriction patterns are known as restriction fragment length polymorphisms (RFLPs). Because RFLPs reflect differences or similarities in nucleotide sequences, REA methods can be used for organism identification and/or for establishing strain relatedness within the same species (Figures 8-17 to 8-19).

Applications of Nucleic Acid–Based Methods Categories for the application of molecular diagnostic microbiology methods are the same as those for conventional, phenotype-based methods: • � Direct detection of microorganisms in patient specimens • � Identification of microorganisms grown in culture • � Characterization of microorganisms beyond basic identification

ABC

• Figure 8-19 Restriction patterns generated by pulsed-field gel electrophoresis for two Streptococcus pneumoniae isolates, one that was susceptible to penicillin (Lane B) and one that was resistant (Lane C), from the same patient. Restriction fragment length polymorphism analysis indicates that the patient was infected with different strains. Molecular-size markers are shown in Lane A.

Nucleic acid–based methods can also be used to validate the result of a negative test using another technique with lower sensitivity, such as rapid diagnostic tests or immunochromatographic “strip” tests.

Direct Detection of Microorganisms Nucleic acid hybridization and target or probe amplification methods are the molecular techniques most commonly used for direct organism detection in clinical specimens.

138 PA RT I I

General Principles in Clinical Microbiology

Advantages and Disadvantages When considering the advantages and disadvantages of nucleic acid–based approaches to direct organism detection, a comparison with the current “gold standard” or most commonly used conventional methods (i.e., direct smears, culture, and microscopy) is helpful. Analytical Specificity

Both hybridization and amplification methods are driven by the specificity of a nucleotide sequence for a particular organism, or analytical specificity. Therefore a positive assay indicates the presence of an organism but also provides the organism’s identity, potentially precluding the need for follow-up culture. Although molecular methods may not be faster than microscopic smear examinations, the opportunity to prevent the delays associated with a culture can be a substantial advantage. However, for many infectious agents, detection and identification are only part of the diagnostic requirement. Determination of certain characteristics, such as strain relatedness or resistance to antimicrobial agents, is often an important diagnostic or epidemiologic component that is not possible without the availability of culture. For this reason, most molecular detection methods target organisms for which antimicrobial susceptibility testing is not routinely needed (e.g., Chlamydia spp.) or for which reliable cultivation methods are not widely available (e.g., Ehrlichia spp.). The high specificity of molecular techniques also presents a limitation in what can be detected with any one assay; that is, most molecular assays focus on detecting the presence of only one or two potential pathogens. Even if tests for those organisms are positive, the possibility of a mixed infection involving other organisms has not been ruled out. If the tests are negative, other procedures may be needed to determine whether additional pathogens are present. In contrast, smear examination and cultivation procedures can detect and identify a broader selection of possible infectious etiologies. Of importance, a follow-up Gram-stained smear may be necessary to determine the clinical relevance of finding a particular organism upon culture or detection using molecular assays. However, a number of novel molecular platforms and reagents have recently emerged that greatly expand the spectrum of detectable organisms in any particular specimen. ASRs for real-time PCR that can detect as many as six to seven organisms are commercially available. In addition, FDA-cleared gastrointestinal, respiratory, and blood culture panels with the ability to concomitantly detect more than 20 different pathogens are available on the BioFire FilmArray automated system. Finally, as mentioned throughout this chapter, a concern associated with any amplification-based assay is the possibility for cross contamination between samples or by amplified byproduct. Thus it is of utmost importance for any laboratory performing these assays to employ measures to prevent false-positive results. Automated and “closed systems” that

integrate sample preparation, amplification, and direct detection greatly reduce the potential for contamination. Analytical Sensitivity

Hybridization-based methods are not completely reliable in directly detecting small numbers of organisms. Analytical sensitivity is defined as the lower limit of organism or nucleic acid concentration for reproducible detection of a pathogen on a specific testing platform. This value can be affected by several factors, including adequacy of specimen collection, assay optimization, interfering substances, and specimen transport and storage. For example, the quantity of target nucleic acid may be insufficient, or the patient specimen may contain substances that interfere with or cross-react in the hybridization and signal-generating reactions. As was discussed with direct hybridization methods, patient specimens may contain substances that interfere with or inhibit amplification reactions such as PCR. Nonetheless, the ability to amplify target or probe nucleic acid to readily detectable levels has provided an invaluable means of overcoming the lack of sensitivity characteristic of most direct hybridization methods. One approach developed by Hologic (Madison, WI) to enhance sensitivity has been to use DNA probes targeted for bacterial ribosomal RNA, of which there are up to 10,000 copies per cell. Essentially, amplification is accomplished by the choice of a target that exists within the cell as multiple copies rather than as a single copy; this may serve to negate the potential effects of interfering substances to preserve the high analytical sensitivity characteristic of tests that target rRNA. Besides the potential for providing more reliable test results than direct hybridization (i.e., fewer false-negative results), amplification methods have other advantages that include: • � Ability to detect nonviable organisms that are not retrievable by cultivation-based methods • � Ability to detect and identify organisms that cannot be grown in culture or are extremely difficult to grow (e.g., hepatitis B virus, Mycoplasma spp., and the agent of Whipple disease) • � More rapid detection and identification of slow-growing organisms (e.g., mycobacteria, certain fungi) • � Ability to detect previously unknown agents directly in clinical specimens by using broad-range primers (e.g., use of primers that anneal to a region of target DNA conserved among all bacteria) • � Ability to quantitate infectious agent burden in patient specimens, an application that has particular importance for managing HIV, cytomegalovirus (CMV), and hepatitis B and hepatitis C infections Despite these significant advantages, limitations still exist, notably the ability to find only the organisms toward which the primers have been targeted. In addition, no cultured organism is available if subsequent characterization beyond identification is necessary. As with hybridization, the first limitation may eventually be addressed using broadrange amplification methods to screen specimens for the presence of any organism (e.g., bacteria, fungi, viruses or

CHAPTER 8 Nucleic Acid–Based Analytic Methods for Microbial Identification and Characterization

parasites). Specimens positive by this test would then be processed further for a more specific diagnosis. The second limitation is more difficult to overcome and is one reason culture methods will remain a major part of diagnostic microbiology for some time to come. An interesting consequence of using highly sensitive amplification methods is the effect on clinical interpretation of results. For example, if a microbiologist detects organisms that are no longer viable, can he or she assume the organisms are or were involved in the infectious process being diagnosed? Also, amplification may detect microorganisms present in insignificant quantities as part of the patient’s normal or transient microbiota, or as an established latent infection, that have nothing to do with the current disease state of the patient. Finally, as previously mentioned, an underlying complication in the development and application of any direct detection method is that various substances in patient specimens can interfere with the hybridization or amplification reaction, thereby reducing analytical sensitivity. Specimen interference is one of the major issues that must be addressed in the design of any useful direct method for molecular diagnosis of infectious diseases.

Applications for Direct Molecular Detection of Microorganisms Given their inherent advantages and disadvantages, molecular direct detection methods are most useful when: • � One or two pathogens cause the majority of infections (e.g., Chlamydia trachomatis and Neisseria gonorrhoeae as common agents of genitourinary tract infections) • � Further organism characterization, such as antimicrobial susceptibility testing, is not required for management of the infection (e.g., various viral agents) • � Either no reliable diagnostic methods exist or they are notably suboptimal (e.g., various bacterial, parasitic, viral, and fungal agents) • � Reliable diagnostic methods exist but are slow (e.g., Mycobacterium tuberculosis) • � Quantitation of infectious agent burden influences patient management (e.g., HIV quantification for monitoring antiretroviral therapy or AIDS progression) A variety of commercially available molecular systems and products for the detection and identification of infectious organisms are currently available. These include automated and semiautomated systems, many of which are included throughout this textbook. In addition, many molecular assays have been developed by research laboratories (laboratorydeveloped tests [LDTS]) associated with academic medical centers. Therefore direct molecular diagnostic methods based on amplification will continue to expand and enhance our understanding and diagnosis of infectious diseases. However, as with any laboratory method, their ultimate utility and application will depend on accuracy, impact on patient care, advantages over currently available methods, and resources required to establish and maintain their use in the diagnostic setting.

139

Identification of Microorganisms Grown in Culture Once organisms are grown in culture, hybridization, amplification, or RFLP analysis may be used to establish identity. Because the target nucleic acid is already amplified via microbial cultivation, sensitivity is not usually a problem for nucleic acid–based identification methods. In addition, extensive nucleotide sequence data are available for most clinically relevant organisms, providing the required information to produce highly specific probes and primers. The criteria often considered in comparing nucleic acid– based and conventional methods for microbial identification include speed, accuracy, and cost. For slow-growing organisms, such as mycobacteria and fungi, culture-based identification schemes can take weeks to months to produce a result. Nucleic-acid based methods can identify these microorganisms almost immediately after sufficient inoculum is available, clearly demonstrating a speed advantage over conventional culture-based methods. For example, Mycobacteria spp. may take several months to culture and correctly identify using phenotypic methods. However, a nucleic acid–based test is available that specifically amplifies a fragment of the DNA encoding the 16s subunit of the rRNA, a genetic characteristic common to all species of mycobacteria. This provides a screening method to detect the presence of a Mycobacterium species within a specimen. This procedure may then be followed by amplification of an insertion sequence (S6110) that is unique and specific for M. tuberculosis. Additional species may be identified using the differential restriction digestion patterns for the hsp65 gene present in all mycobacteria. Historically, phenotypicbased methods used to identify frequently encountered bacteria, such as S. aureus and beta-hemolytic streptococci, can usually provide highly accurate results within minutes and are less costly and time-consuming than any currently available molecular method. Rapid, point-of-care (POC) tests that use real-time PCR–based methods are now commercially available for MRSA screening of patients upon admission to a long-term care or hospital facility. This technology provides for immediate isolation of carriers, preventing the spread of nosocomial infections throughout the facility. Although many of the phenotype-based identification schemes are highly accurate and reliable, in some situations phenotypic profiles may yield uncertain identifications. Nucleic acid–based methods are providing an alternative for establishing a definitive or confirmatory organism identification. This is especially true when a common pathogen exhibits unusual phenotypic traits (e.g., optochin-resistant Streptococcus pneumoniae).

Characterization of Microorganisms Beyond Identification Situations exist in which characterizing a microbial pathogen beyond identification provides important information for patient management and public health. In such situations,

140 PA RT I I

General Principles in Clinical Microbiology

knowledge regarding an organism’s virulence, resistance to antimicrobial agents, or relatedness to other strains of the same species can be extremely important. Although various phenotypic methods have been able to provide some of this information, the development of nucleic acid–based testing has greatly expanded the capability to generate this information in the diagnostic setting in a more timely fashion. This is especially true with regard to antimicrobial resistance and strain relatedness among bacteria.

Detection of Antimicrobial Resistance As are all phenotypic traits, those that render microorganisms resistant to antimicrobial agents are encoded on specific genes (for more information regarding antimicrobial resistance mechanisms, see Chapter 10). Therefore nucleic acid–based tests can be used to detect the genes encoding the antimicrobial resistance. In many ways, phenotypic methods for resistance detection are reliable and are the primary methods for antimicrobial susceptibility testing (see Chapter 11). However, the complexity of emerging resistance mechanisms often challenges the ability of commonly used susceptibility testing methods to “keep up” with the evolving patterns of resistance in a population. As with the nucleic acid–based identification previously described, Mycobacterium spp. resistant to rifampin and isoniazid may be readily identified using nucleic acid– based methods by targeting the rpoB and katG genes. Methods such as PCR play a role in the detection of certain resistance profiles that may not always readily be detected by phenotypic methods. Two such examples include detection of the van genes, which mediate vancomycin resistance among enterococci (Figure 8-17), and the mec gene, which encodes resistance among staphylococci to all currently available drugs of the beta-lactam class (Figure 8-18). Undoubtedly, conventional and molecular methods will both continue to play key roles in the characterization of microbial resistance to antimicrobial agents.

Investigation of Strain Relatedness and PulsedField Gel Electrophoresis An important component of recognizing and controlling disease outbreaks inside or outside of a hospital is identification of the reservoir and mode of transmission of the infectious agents involved. Strain typing provides a mechanism for monitoring the spread of drug-resistant pathogens, the evaluation of multiple isolates from a single patient, and differentiation of relapse from a new infection. Epidemiology and infection control measures often require establishing relatedness among the pathogens isolated during an outbreak. For example, if all the microbial isolates thought to be associated with a nosocomial infection outbreak are shown to be identical or at least very closely related, then a common source or reservoir for those isolates must be identified. If the etiologic agents are not the same, other explanations for the outbreak must be investigated (Chapter 79). Because each species of a microorganism comprises an almost limitless number of strains, identification of an organism to the species level is not sufficient for establishing relatedness.

Strain typing, the process used to establish the relatedness among organisms belonging to the same species, is required. Although phenotypic characteristics (e.g., biotyping, serotyping, antimicrobial susceptibility profiles) historically have been used to type strains, these methods often are limited by their inability to consistently discriminate between different strains, their labor intensity, or their lack of reproducibility. In contrast, certain molecular methods do not have these limitations and have enhanced strain-typing capabilities. The molecular typing methods either directly compare nucleotide sequences between strains or produce results that indirectly reflect similarities in nucleotide sequences among “outbreak” organisms. Indirect methods usually involve enzymatic digestion and electrophoresis of microbial DNA to enable RFLP analysis. Several molecular methods have been investigated for establishing strain relatedness (Table 8-4). The method chosen primarily depends on the extent to which the following four criteria proposed by Maslow and colleagues are met: • � Typeability: The method’s capacity to produce clearly interpretable results with most strains of the bacterial species to be tested

TABLE Examples of Methods to Determine Strain 8-4 Relatedness

Method

Advantages/Limitations

Plasmid analysis

Simple to implement but cannot often discriminate because many bacterial species have few or no plasmids

Multilocus enzyme electrophoresis

Provides only an estimate of overall genetic relatedness and diversity (protein-based)

Multilocus sequence typing

Data are electronically portable and used as non–culture-based typing method; labor intensive and expensive

Pulsed-field gel electrophoresis

Highly discriminatory but it is difficult to resolve bands of similar size and interlaboratory reproducibility is limited

Randomly amplified polymorphic deoxyribonucleic acid (DNA)

High discriminatory power but poor laboratory interlaboratory and intralaboratory reproducibility due to short random primer sequences and low polymerase chain reaction (PCR) annealing temperatures

Repetitive sequence–based PCR

Manual system: Useful for strain typing, but low rates of interlaboratory reproducibility; suboptimal turnaround times (TATs) for both manual and automated systems Automated system: Increased reproducibility and decreased TATs

Ribotyping and PCR ribotyping

Difficult to distinguish among different subtypes

CHAPTER 8 Nucleic Acid–Based Analytic Methods for Microbial Identification and Characterization

• � Reproducibility: The method’s capacity to repeatedly obtain the same typing profile result with the same bacterial strain • � Discriminatory power: The method’s ability to produce results that clearly allow differentiation between unrelated strains of the same bacterial species • � Practicality: The method should be versatile, relatively rapid, inexpensive, technically simple, and provide readily interpretable results The last criterion, practicality, is especially important for busy clinical microbiology laboratories that provide support for infection control and hospital epidemiology. Among the molecular methods used for strain typing, pulsed-field gel electrophoresis (PFGE) meets most of Maslow’s criteria for a good typing system and is frequently referred to as the microbial typing “gold standard.” This method is applicable to most of the commonly encountered bacterial pathogens, particularly those frequently associated with nosocomial infections and outbreaks, such as staphylococci (MRSA), enterococci (vancomycin-resistant enterococci), and gram-negative pathogens, including Escherichia coli and Klebsiella, Enterobacter, and Acinetobacter spp. For these reasons, PFGE has been widely accepted among microbiologists, infection control personnel, and infectious disease specialists as a primary laboratory tool for epidemiology.

1.Cultureof bacterialcells

PFGE uses a specialized electrophoresis device to separate chromosomal fragments produced by enzymatic digestion of intact bacterial chromosomal DNA. Bacterial suspensions are first embedded in agarose plugs, where they are carefully lysed (lysozyme) to release intact chromosomal DNA; the interfering contaminating proteins are then removed by treating the sample with proteinase K; the DNA is then digested using restriction endonuclease enzymes. Enzymes that have relatively few restriction sites on the genomic DNA are selected so that 10 to 20 DNA fragments ranging in size from 10 to 1000 kb are produced (Figure 8-20). Because of the large DNA fragment sizes produced, resolution of the banding patterns requires the use of a pulsed electrical field across the agarose gel that subjects the DNA fragments to different voltages from varying angles at different time intervals. Although comparison and interpretation of RFLP profiles produced by PFGE can be complex, the basic premise is that strains with the same or highly similar digestion profiles share substantial similarities in their nucleotide sequences and therefore are likely to be most closely related. For example, in Figure 8-19, isolates 1 and 2 have identical RFLP patterns, whereas isolate 3 has only 7 of its 15 bands in common with either isolates 1 or 2. Therefore isolates 1 and 2 would be considered closely related, if not identical, whereas isolate 3 would not be considered related to the other two isolates.

Isolate2

Isolate1

Chromosomal DNA 2.Celllysisand releaseofDNA

3.Enzymatic digestionofDNA DNAdigestion fragments 4.Gelelectrophoresis andrestriction fragmentlength polymorphism(RFLP) analysis

141

Restriction Restriction Restriction pattern, pattern, pattern, Isolate1 Isolate2 Isolate3

• Figure 8-20 Procedural steps for pulsed-field gel electrophoresis (PFGE).

Isolate3

142 PA RT I I

General Principles in Clinical Microbiology

One example of PFGE application for the investigation of an outbreak is shown in Figure 8-17. After Sma I endonuclease enzymatic digestion of DNA from seven vancomycinresistant E. faecalis isolates, RFLP profiles show that the resistant isolates are probably the same strain. Such a finding strongly supports the probability of clonal dissemination of the same vancomycin-resistant strain among the patients from which the organisms were isolated. The discriminatory advantage that PFGE profiles have over phenotype-based typing methods is demonstrated in Figure 8-18. Because all six methicillin-resistant S. aureus isolates exhibited identical antimicrobial susceptibility profiles, they were initially thought to be the same strain. However, PFGE profiling established that only isolates B and C were the same. PFGE can also be used to determine whether a recurring infection in the same patient is due to insufficient original therapy, possibly as a result of developing antimicrobial resistance during therapy, or to acquisition of a second, more resistant, strain of the same species. Figure 8-19 shows restriction patterns obtained by PFGE with S. pneumoniae isolated from a patient with an unresolved middle ear infection. The PFGE profile of isolate B, which was fully susceptible to penicillin, differs substantially from the profile of isolate C, which was resistant to penicillin. The clear difference in PFGE profiles between the two strains indicates that the patient was most likely reinfected with a second, more resistant, strain. Alternatively, the patient’s original infection may have been a mixture of both strains, with the more resistant one being lost during the original culture workup. In any case, this application of PFGE demonstrates that the method not only is useful for investigating outbreaks or strain dissemination involving several patients, it also gives us the ability to investigate questions regarding reinfections, treatment failures, and mixed infections involving more than one strain of the same species.

Automation and Advances in Molecular Diagnostic Instrumentation Molecular diagnostics has traditionally required extensive hands-on technical expertise to process specimens, extract the nucleic acids, amplify, and detect the target sequence. In addition, the high cost of consumable reagents and instrumentation initially limited molecular diagnostics to large, centralized clinical laboratories, research hospitals, and public health departments. However, technologic advances have rapidly changed the diagnostic microbiology laboratory, making nucleic acid–based testing accessible to the vast majority of clinical labs even in small local and regional hospitals. Traditional amplification instruments are still available (e.g., basic thermal cyclers); however, real-time amplification and detection as well as fully automated closed systems are rapidly replacing these instruments. This new generation of instruments facilitate the amplification and analysis of numerous samples simultaneously in a single run (e.g., increasing throughput) and reduce the amount of hands-on interaction required (e.g., mixing or adding reagents) with

preloaded reagent packs and/or microfluidic components. Generally speaking, the overall cost of these automated and semiautomated instruments has also sharply declined in the past few years, making them financially viable in many clinical laboratories. These trends toward greater automation, user-friendliness, and reduced cost are expected to continue, making molecular diagnostic testing increasingly available worldwide. See Table 8-1 for an overview and sample of instrumentation available for use in the molecular microbiology laboratory. Instruments on the horizon for molecular detection of microbial pathogens in the clinical laboratory include whole genome next generation sequencing (WG-NGS) and mass spectrometry (MS). Both of these technologies overcome the most limiting factor for PCR and other amplification- or hybridization-based techniques (i.e., the ability to detect only predefined targets, which requires the physician to establish an etiologic hypothesis before testing). Rather than using specific primers to amplify a target sequence, WG-NGS relies upon random amplification and sequencing all nucleic acids found in a clinical sample, potentially including host DNA and the microbiome within a specimen. The sequences obtained are compared with a sequence database to establish what microbial species and strains are present in the sample that could be causing disease and predict their antimicrobial phenotype or virulence. Mass spectrometry using matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF MS), on the other hand, as previously described in Chapter 7, analyzes the unique spectrum of nucleic acids, proteins, and peptides obtained from a cultured microbial isolate or PCR-amplified sample. Several mass spectrometry instruments have already received FDA clearance for microbial identification (e.g., VITEK MS from bioMérieux, Lyon, France, and Plex-ID Pathogen Detector from Iridica/Abbott Molecular, Abbott Laboratories, Abbott Park, IL). As these technologies continue to evolve, the cost and speed of testing is expected to decline, such that WG-NGS and MS will become routine tests in infectious disease diagnostics. Visit the Evolve site for a complete list of procedures, review questions, and case study answers.

Bibliography Buckingham L: Molecular diagnostics, fundamentals, methods, and clinical applications, ed 2, Philadelphia, 2012, FA Davis. Chapin K, Musgnug M: Evaluation of three rapid methods for the direct detection of Staphylococcus aureus from positive blood cultures, J Clin Microbiol 41:4324, 2003. Cockerill FR: Application of rapid-cycle real-time polymerase chain reaction for diagnostic testing in the clinical microbiology laboratory, Arch Pathol Med 127:1112, 2003. Fairfax MR, Salimnia H: Diagnostic molecular microbiology: a 2013 snapshot, Clin Lab Med 33:787-803, 2013. Fong WK, Modrusan Z, Mcnevin JP, et al: Rapid solid-phase immunoassay for detection of methicillin-resistant Staphylococcus

CHAPTER 8 Nucleic Acid–Based Analytic Methods for Microbial Identification and Characterization

aureus using cycling probe technology, J Clin Microbiol 38: 2525-2529, 2000. Fontana C, Favaro M, Pelliccioni M, et al: Use of the MicroSeq 5000 16S rRNA gene-based sequencing for identification of bacterial isolates that commercial automated systems failed to identify correctly, J Clin Microbiol 43:615, 2005. Forbes BA: Introducing a molecular test into the clinical microbiology laboratory, Arch Pathol Med 127:1106, 2003. Ginocchio CC: Life beyond PCR: alternative target amplification technologies for the diagnosis of infectious diseases. Part I, Clin Microbiol Newsl 26:121, 2004. Ginocchio CC: Life beyond PCR: alternative target amplification technologies for the diagnosis of infectious diseases. Part II, Clin Microbiol Newsl 26:129, 2004. Goering RV: Molecular strain typing for the clinical laboratory: current application and future direction, Clin Microbiol Newsl 22:169, 2000. Haanpera M, Huovinen P, Jalava J: Detection and quantification of macrolide resistance mutations at positions 2058 and 2059 of the 23s rRNA gene by pyro-sequencing, Antimicrob Agent Chemother 49:457-460, 2005. Hall L, Wohlfiel S, Roberts GD: Experience with the MicroSeq D2 large-subunit ribosomal DNA sequencing kit for identification of commonly encountered clinically important yeast species, J Clin Microbiol 41:5009, 2003. Healy M, Huong J, Bittner T, et al: Microbial DNA typing by automated repetitive-sequenced-based PCR, J Clin Microbiol 43:199, 2005. Hindson BJ, Ness KD, Masquelier DA, et al: High-throughput droplet digital PCR system for absolute quantitation of DNA copy number, Anal Chem 83:8604-8610, 2011. Jorgensen J, Pfaller M, Carroll K, et al: Manual of clinical microbiology, ed 11, Washington, DC, 2015, ASM Press. Jung C, Chung JW, Kim UO, et al: Isothermal target and signaling probe amplification method, based on a combination of an isothermal chain amplification technique and a fluorescence resonance energy transfer cycling probe technology, Anal Chem 82:5937-5943, 2010.

143

Kirchgesser M, vonFelten C, Kalin C, et al: The new MagNa Pure LC 2.0 system: new design and improved performance combined with a proven nucleic acid isolation technique, Roche Applied Science, Biochemica 3:20, 2008. Mackay IM: Real-time PCR in the microbiology laboratory, Clin Microbiol Infect 10:190, 2004. Maslow JN, Mulligan ME, Arbeit RD: Molecular epidemiology: application of contemporary techniques to the typing of microorganisms, Clin Infect Dis 17:153, 1993. Maruin M: Real-time PCR as a diagnostic tool for bacterial diseases, Expert Rev Mol Diagn 12:731-754, 2012. McGowin CL, Rohde RE, Whitlock GC: Other pathogens of significant public health concern. In Hu P, Hedge M, Lennon PA, editors: Modern clinical molecular techniques (new edition), New York, 2012, Springer Press. McGowin CL, Rohde RE, Redwine G: Molecular diagnosis of sexually transmitted infections: a diverse and dynamic landscape, Clin Lab Sci 27:40-42, 2014. Navarro E, Serrano-Heras G, Castano MJ, Solera J: Real-time PCR detection chemistries, Clinica Chimica Acta 439:231-250, 2015. Oliviera K, Brecher SM, Durbin A, et al: Direct identification of Staphylococcus aureus from positive blood culture bottles, J Clin Microbiol 41:889, 2003. Rohde RE, Mayes BC: Molecular diagnosis and epidemiology of rabies. In Hu P, Hedge M, Lennon PA, editors: Modern clinical molecular techniques (new edition), New York, 2012, Springer Press. Tenover FC, Arbeit RD, Goering RV, et al: Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing, J Clin Microbiol 33:2233, 1995. Wang D, Urisman A, Liu YT, et al: Viral discovery and sequence recovery using DNA microarrays, PLOS Biol 1:2, 2003. Wetmur JG: DNA probes: applications of the principles of nucleic acid hybridization, Crit Rev Biochem Mol Biol 26:227, 1991. Yan L, Zhou J, Zheng Y, et al: Isothermal amplified detection of DNA and RNA, Mol Bio Syst 10:970-1002, 2014.

9

Overview of Immunochemical Methods Used for Organism Detection OBJECTIVES 1. Define the two categories of human specific immune response, cell mediated and antibody mediated, including the definition of T cells and B cells and their role in the responses. 2. List the five classes of antibodies, define their roles in infectious disease, and explain the three antibody functions. 3. Explain the following serologic tests, giving consideration to their clinical applications: direct, indirect and reverse passive agglutination, flocculation tests, immunofluorescent assays, and enzyme immunoassay. 4. Describe a cross-reaction and explain why it occurs and how it may affect antibody testing. 5. In defining hemagglutination and neutralization assays, explain their similarity in testing, along with their disparities. 6. Explain how the difference in the size and structure of the IgM antibody is important to its activity and function. 7. Explain what the complement fixation test is and describe the two-step reaction. 8. Explain the principle of the Western blot assay and why it is used as a confirmatory test for many assays. 9. Define a polyclonal antibody and a monoclonal antibody and explain the difference between the two. 10. Explain how monoclonal antibodies are produced. How has their development affected immunochemical testing? 11. Explain the difference between a direct fluorescent antibody (DFA) test and an indirect fluorescent antibody (IFA) test and explain how each is used in the clinical laboratory. 12. Explain the function of the hypoxanthine, aminopterin, and thymidine (HAT) medium in hybridoma production.

T

he diagnosis of an infectious disease by culture and biochemical techniques can be hindered by several factors. These factors include the inability to cultivate an organism on artificial media, such as is the case with Treponema pallidum, the agent that causes syphilis, or the fragility of an organism and its subsequent failure to survive transport to the laboratory, such as with respiratory syncytial

144

virus (RSV) and varicella-zoster virus (VZV). Another factor, the fastidious nature of some organisms (e.g., Leptospira spp. or Bartonella spp.), can result in long incubation periods before growth is evident. In addition, administration of antimicrobial therapy before specimen collection, such as with a patient who has received partial treatment, can impede diagnosis. In these cases, detecting a specific product of the infectious agent in clinical specimens is very important, because this product would not be present in the specimen in the absence of the agent. This chapter provides a basic overview of the immune system and its functions and the direct detection of microorganisms in patient specimens using immunochemical methods and the identification of microorganisms. Specific information and the application of immunochemical methods used for organism identification is included in Parts III through VI of this textbook. Immunochemical methods are used as diagnostic tools for serodiagnosis of infectious disease. An understanding of how these methods have been adapted for this purpose requires a basic working knowledge of the components and functions of the immune system. Immunology is the study of the components and functions of the immune system. The immune system is the body’s defense mechanism against invading “foreign” antigens. One of the functions of the immune system is distinguishing “self ” from “nonself ” (i.e., the proteins or antigens from foreign substances). (Chapter 3 presents a more in-depth discussion of the host’s response to foreign substances.) This chapter is intended to provide a brief overview and review of immunology. The complexity and detail required to fully understand immunology and serology are beyond the scope of this text.

Features of the Immune Response The host, or patient, has physical barriers, such as intact skin and ciliated epithelial cells, and chemical barriers, such as oils produced by the sebaceous glands and lysozyme found in tears and saliva, to prevent infections by foreign organisms. In addition, natural (innate) immunity, which is not specific, activates chemotaxis, the process by which phagocytes

CHAPTER 9  Overview of Immunochemical Methods Used for Organism Detection

are recruited to a site of invasion and engulf organisms entering the host. Acquired active immunity is the specific response of the host to an infecting organism. The human specific immune responses are simplistically divided into two categories: cell mediated and antibody mediated. Cell-mediated immune responses are carried out by special lymphocytes of the T-cell (thymus derived) class. T cells proliferate and differentiate into various effector T cells, including cytotoxic and helper cells. Cytotoxic T lymphocytes (Tc) specifically attack and kill microorganisms or host cells damaged or infected by pathogens. Helper T lymphocytes (Th) promote the maturation of B lymphocytes by producing activator cytokines that induce the B cells to produce antibodies and attach to and kill invading organisms. Although diagnosis of certain diseases may be aided by measuring the cell-mediated immune response to the pathogen, such tests entail skin tests performed by physicians or in vitro cell function assays performed by specially trained immunologists. These tests are usually not within the repertoire of clinical microbiology laboratories. Immunochemical methods use antigens and antibodies as tools to detect microorganisms. Antigens are substances recognized as “foreign” in the human body. Antigens are usually high-molecular-weight proteins or carbohydrates that elicit the production of other proteins, called antibodies, in a human or animal host (Chapter 3). Antibodies attach to the antigens and aid the host in removing the infectious agent. Antigens may be part of the physical structure of the pathogen, such as the bacterial cell wall, or they may be a chemical produced and released by the pathogen, such as an enzyme or a toxin. Each antigen contains a region that is recognized by the immune system. These regions are referred to as antigenic determinants or epitopes. Figure 9-1 shows the multiple molecules within group A streptococcus (Streptococcus pyogenes) that are recognized by the immune system as antigenic. Capsule (hyaluronic acid) T, R proteins Polysaccharide N-acetyl glucosamine N-acetyl galactosamine rhamnose, glucose, galactose (group-specific antigens) Fimbriae (M protein) Teichoic acid Lipoteichoic acid

Streptolysin O enzyme DNase enzyme Hyaluronidase enzyme Streptokinase enzyme Peptidoglycan N-acetyl glucosamine N-acetyl muramic acid Cytoplasmic membrane

• Figure 9-1  Group A streptococci (Streptococcus pyogenes) contain many antigenic structural components and produces various antigenic enzymes, each of which may elicit a specific antibody response from the infected host.

145

Antibody-mediated immune responses are produced by specific proteins generated by lymphocytes of the B-cell (bone marrow–derived) class. These proteins are made in response to the antigens or antigenic determinants of a specific infectious agent. The proteins generated in response to the foreign agent demonstrate immunologic function and fold into a globular structure in the active state; they are referred to as immunoglobulins or antibodies. Antibodies are either secreted into the blood or lymphatic fluid (and sometimes other body fluids) by plasma cells (activated B lymphocytes), or they remain attached to the surface of the lymphocyte or other cells. Because the cells involved in this category of immune response primarily circulate in the blood, this type of immunity is also called humoral immunity. For purposes of determining whether a patient’s body has produced an antibody against a particular infectious agent, the serum (or occasionally the plasma) is examined for the presence of the antibody. The study of the diagnosis of disease by measuring antibody levels in serum is referred to as serology.

Characteristics of Antibodies Immunocompetent humans are able to produce antibodies specifically directed against almost all the antigens with which they may come into contact throughout their lifetimes and that the body recognizes as “foreign.” Antigens may be part of the physical structure of a pathogen or a chemical produced and released by the pathogen, such as an exotoxin. One pathogen may contain or produce many different antigens that the host recognizes as foreign. Infection with one agent may cause the production of a number of different antibodies. In addition, some antigenic determinants on a pathogen may not be available for recognition by the host until the pathogen has undergone a physical change. For example, until a pathogenic bacterium has been digested by a human polymorphonuclear (PMN) leukocyte, certain antigens deep in the cell wall are not detected by the host immune system. Once the bacterium has been broken down, these new antigens are released and the specific antibodies can be produced. For this reason, a patient may produce different antibodies at different times during the course of a single disease. The immune response to an antigen also matures with continued exposure, and the antibodies produced become more specific and more avid (able to bind more tightly). Antibodies function by (1) attaching to the surface of pathogens and making the pathogens more amenable to ingestion by phagocytic cells (opsonizing antibodies); (2) binding to and blocking surface receptors for host cells (neutralizing antibodies); or (3) attaching to the surface of pathogens and contributing to their destruction by the lytic action of complement (complement-fixing antibodies). Routine diagnostic serologic methods are used to measure primarily two antibody classes, IgM and IgG; however, antibodies are categorized into five classes: immunoglobulin G (IgG), immunoglobulin M (IgM), immunoglobulin A (IgA), immunoglobulin D (IgD), and immunoglobulin E

146 PA RT I I   General Principles in Clinical Microbiology

(IgE). IgA, also referred to as secretory antibody, is the predominant class of antibody in saliva, tears, and intestinal secretions. IgD is attached to the surface of B cells and is involved in immune regulations. IgE levels increase as a result of infections caused by several parasites or in response to allergic reactions. The basic structure of an antibody molecule comprises two mirror images, each composed of two identical protein chains (Figure 9-2). At the terminal ends are the antigenbinding sites, or variable regions, which specifically attach to the antigen against which the antibody was produced. Depending on the specificity of the antibody, antigens of some similarity, but not total identity, to the inducing antigen may also be bound; this is called a cross reaction. The complement-binding site is found in the center of the molecule in a structure similar for all antibodies of the same class and is referred to as the constant region. IgM is produced as a first response to many antigens, although the levels remain high transiently. Thus the presence of IgM usually indicates recent or active exposure to an antigen or infection. IgG, on the other hand, may persist long after an infection has run its course. The IgM antibody type (Figure 9-3) consists of five identical proteins (pentamer), with the basic antibody structures linked at the bases with 10 antigen binding sites on the molecule. IgG consists of one basic antibody molecule (monomer) that has two binding sites. The differences in the size and conformation between these two classes of immunoglobulins result in differences in activities and functions.

Features of the Humoral Immune Response Useful in Diagnostic Testing Immunocompetent individuals produce both IgM and IgG antibodies in response to most pathogens. In most cases, IgM is produced by a patient after the first exposure to a pathogen and is no longer detectable within a relatively short period. For serologic diagnostic purposes, it is important to note that IgM is unable to cross the placenta. Therefore any

Antigenbinding region

Light chain Complement-binding area Heavy chain Disulfide bond

Constant regions

Fc portion

Variable regions

Fab fragments

• Figure 9-2  Structure of immunoglobulin G. The heavy chains determine the antibody class (IgG, IgA, IgD, IgE, or IgM). The Fab fragment containing the variable regions determines the antibody-binding specificity. The Fc portion (or function cells) binds to various immune cells to activate specific functions in the immune system.

Antigen-binding site J chain Complementfixing region

Light chain

Heavy chain

• Figure 9-3  Structure of immunoglobulin M.

IgM detected in the serum of a newborn must have been produced by the infant and indicates an infection in utero. The larger number of binding sites on IgM molecules provides for more rapid clearance of the offending pathogen, even though each individual antigen-binding site may not be the most efficient for binding to the antigen. Over time, the cells producing IgM switch to production of IgG. IgG is the most prevalent circulating antibody in the human body. IgG is often more specific for the antigen (i.e., it has higher avidity). IgG has two antigen-binding sites, but it can also bind complement. Complement is a complex series of serum proteins that is involved in modulating several functions of the immune system, including cytotoxic cell death, chemotaxis, and opsonization. When IgG is bound to an antigen, the base of the molecule (Fc portion) is exposed in the environment. Structures on this Fc portion attract and bind the cell membranes of phagocytes, increasing the chances of engulfment and destruction of the pathogen by the host cells. A second exposure to the same pathogen induces a faster and greater IgG response and a much lesser IgM response. Several B lymphocytes retain memory of the pathogen, allowing for a more rapid response and a higher level of antibody production than the primary exposure or response. This enhanced response is called the anamnestic response. B-cell memory is not perfect. Occasional clones of memory cells can be stimulated through interaction with an antigen that is similar but not identical to the original antigen. Therefore the anamnestic response may be polyclonal and nonspecific. For example, reinfection with cytomegalovirus (CMV) may stimulate memory B cells to produce antibody against EpsteinBarr virus (EBV) (another herpes family virus), which the host encountered previously, in addition to antibody against cytomegalovirus. The relative humoral responses are diagrammatically represented in Figure 9-4.

Interpretation of Serologic Tests In serology, a change in antibody titer is a central concept for the diagnosis and monitoring of disease progression.

CHAPTER 9  Overview of Immunochemical Methods Used for Organism Detection

Primary

Secondary

Antibody titer

Anamnestic response

lgG lgM

Low level remains Time

First exposure

• Figure 9-4  Relative

Second exposure humoral response to antigen stimulation over

time.

The titer of antibody is the reciprocal of the highest dilution of the patient’s serum in which the antibody is still detectable. Patients with large amounts of antibody have high titers, because antibody is still detectable at very high dilutions of serum. Serum for antibody levels should be drawn during the acute phase of the disease (when it is first discovered or suspected) and again during convalescence (usually at least 2 weeks later). These specimens are called acute and convalescent sera. For some infections, such as legionnaires’ disease and hepatitis, titers may not rise until months after the acute infection, or they may never rise. Therefore changes in titer must be carefully correlated with the patient’s signs and symptoms of the specific disease or suspected infectious agent. Patients with intact humoral immunity develop increasing amounts of antibody to a pathogen over several weeks. If it is the patient’s first exposure to the pathogenic organism and the specimen has been obtained early enough, no or very low titers of antibody are detected at the onset of disease. In the case of a second exposure, the patient’s serum usually contains measurable antibody during the initial phase of the disease, and the antibody level quickly increases as a result of the anamnestic response. For most pathogens, an increase in the patient’s titer of two doubling dilutions (e.g., from a positive result of 1:8 to a positive result of 1:32) is considered to be diagnostic of current infection. This is described as a fourfold rise in titer. For many infections, accurate results used for diagnosis are achieved when acute and convalescent sera are tested concurrently in the same test system. Variables inherent in the procedures and laboratory error can cause a difference of one doubling (or twofold) dilution in the results obtained from the same sample tested concurrently in different laboratories. Unfortunately, a certain proportion of infected patients never demonstrate a rise in titer, necessitating the use of other diagnostic tests. Because the delay inherent in testing paired acute and convalescent sera results in diagnostic information becoming available too late to affect the initial therapy, increasing numbers of early (IgM) serologic testing assays are being commercially evaluated. Moreover, it is

147

sometimes more realistic to see a fourfold fall in titer between acute and convalescent sera when samples are tested concurrently in the same system. This is a result of the sera being collected late in the course of an infection, when antibodies have already begun to decrease. The prevalence of antibody to an etiologic agent of disease in the population correlates with the number of people who have come into contact with the agent, not the number who actually develop disease. For most diseases, only a small proportion of infected individuals actually develop symptoms; others develop protective antibodies without experiencing signs and symptoms of the disease whether the individual has developed a true immunity to infection or a secondary reinfection. Alternatively, depending on the etiologic agent, even low levels of antibody may protect a patient from pathologic effects of disease and not prevent reinfection. For example, a person previously immunized with killed poliovirus vaccine who becomes infected with pathogenic poliovirus experiences multiplication of the virus in the gut and virus entry into the circulation. Damage to the central nervous system is blocked by humoral antibody in the circulation. Moreover, patients may respond to an antigenic stimulus by producing cross-reacting antibodies. These antibodies are nonspecific and may cause misinterpretation of serologic tests. Table 9-1 provides a brief list of representative serologic tests available for immunodiagnosis of infectious diseases, the specimen required, interpretation of positive and negative test results, and examples of applications of each technique. Because serologic assays are rapidly evolving, this table is not intended to be all-inclusive.

Production of Antibodies for Use in Laboratory Testing Polyclonal Antibodies Because an organism contains many different antigens, the host response produces many different antibodies to these antigens; these antibodies are heterogenous and are called polyclonal antibodies. Polyclonal antibodies used in immunodiagnosis are prepared by immunizing animals (usually rabbits, sheep, or goats) with an infectious agent and then isolating and purifying the resulting antibodies from the animal’s serum. Antibody idiotype variation is caused by alterations in the nucleotide sequence during antibody production. Individual animals are able to produce different antibodies with different idiotypes (antigen binding sites). This variation in antigen-binding sites creates a lack of uniformity in polyclonal antibody reagents and requires continual monitoring and comparisons of different antibody reagent lots for specificity and avidity in any given immunochemical test system.

Monoclonal Antibodies Monoclonal antibodies are antibodies that are completely characterized and highly specific. The ability to create an

148 PA RT I I   General Principles in Clinical Microbiology

TABLE Noninclusive Overview of Tests Available for Serodiagnosis of Infectious Diseases 9-1

Test

Sera needed

Interpretation

Application

IgM

Single, acute (collected at onset of illness)

Newborn, positive: in utero (congenital) infection Adult, positive: primary or current infection Adult, negative: no infection or past infection

Newborn: STORCH agents; other organisms Adults: any infectious agent

IgG

Acute and convalescent (collected 2-6 weeks after onset)

Positive: fourfold rise or fall in titer between acute and convalescent sera tested at the same time in the same test system Negative: no current infection or past infection, or patient is immunocompromised and cannot mount a humoral antibody response, or convalescent specimen collected before increase in IgG (Lyme disease, Legionella sp.)

Any infectious agent

IgG

Single specimen collected between onset and convalescence

Adult, positive: evidence of infection at some unknown time except in certain cases in which a single high titer is diagnostic (rabies, Legionella, Ehrlichia spp.). Newborn, positive: maternal antibodies that crossed the placenta Newborn, negative: patient has not been exposed to microorganism or patient has a congenital or acquired immune deficiency or specimen collected before increase in IgG (Lyme disease or Legionella sp.)

Any infectious agent

Immune status evaluation

Single specimen collected at any time

Positive: previous exposure Negative: no exposure

Rubella testing for women of childbearing age, syphilis testing may be required in some states to obtain a marriage license, cytomegalovirus testing for transplant donor and recipient

STORCH, Syphilis, Toxoplasma, rubella virus, cytomegalovirus, herpes simplex virus.

immortal cell line that produces large quantities of a monoclonal antibody has revolutionized immunologic testing. Monoclonal antibodies are produced by the fusion of a malignant single antibody-producing myeloma cell with an antibody-producing plasma B cell, forming a hybridoma cell. Clones of the hybridoma cells continuously produce specific monoclonal antibodies. One technique for the production of a clone of cells is illustrated in Figure 9-5. The process starts with immunization of a mouse with the antigen for which an antibody is to be produced. The animal responds by producing many antibodies to the epitope (antigenic determinant) injected. The mouse’s spleen is removed and emulsified to separate antibody-producing plasma cells. The cells are then placed into individual wells of a microdilution tray. Viability of cells is maintained by fusing them with cells capable of continuously propagating, or immortal cells of a multiple myeloma. A multiple myeloma is a disease that produces a malignant tumor

containing antibody-producing plasma cells. Myeloma tumor cells used for hybridoma production are deficient in the enzyme hypoxanthine phosphoribosyl transferase. This defect leads to their inability to survive in a medium containing hypoxanthine, aminopterin, and thymidine (HAT medium). Antibody-producing spleen cells, however, contain the enzyme. Thus fused hybridoma cells survive in the selective medium and can be recognized by their ability to grow indefinitely in the medium. Unfused antibody-producing lymphoid cells die after several multiplications in vitro because they are not immortal, and unfused myeloma cells die in the presence of the toxic enzyme substrates. The only surviving cells are true hybrids. The growth medium supernatant from the microdilution tray wells in which the hybridoma cells are growing is then tested for the presence of the desired antibody. Many such cell lines are usually examined before a suitable antibody is identified. The antibody must be specific enough to bind to

CHAPTER 9  Overview of Immunochemical Methods Used for Organism Detection

Antigen Polyclonal antiserum Antibodyproducing cells Spleen

Fused cells

Polyethylene glycol fusion Myeloma cells

Hybridoma cells (one specific antibody per cell) Best antibody-producing cell cloned and expanded Antibody produced in culture supernatant Antibody produced in mouse ascites fluid

• Figure 9-5  Production of a monoclonal antibody.

the individual antigenic determinant to which the animal was exposed, but not so specific that it binds only to the antigen from the particular strain of organism with which the mouse was first immunized. When a good candidate antibody-producing cell is found, the hybridoma cells are either grown in cell culture in vitro or are reinjected into the peritoneal cavities of many mice, where the cells multiply and produce large quantities of antibody in the ascitic (peritoneal) fluid. Ascitic fluid can be removed from mice many times during the animals’ lifetime, providing a continual supply of antibody formed to the originally injected antigen. Polyclonal and monoclonal antibodies are both used in commercial systems to detect infectious agents.

IgM Clinical Significance IgM testing is especially helpful for diseases that have nonspecific clinical presentations, such as toxoplasmosis, and for conditions that require rapid therapeutic decisions. For example, rubella infection in pregnant women can lead to congenital defects in the unborn fetus, such as cataracts, glaucoma, mental retardation, and deafness. Therefore pregnant women who are exposed to rubella virus and develop a mild febrile illness can be tested for the presence of antirubella IgM. In addition, identification of IgM within the amniotic fluid of a pregnant mother is diagnostic of neonatal infection. Because IgG can readily cross the placenta, newborns carry titers of IgG passed from the mother to the fetus during the first 2 to 3 months of life until the infant produces his or her own antibodies. This is

149

the only form of natural passive immunity. Accurate serologic diagnosis of infection in neonates requires either demonstration of a rise in titer (which takes time to occur) or the detection of specific IgM directed against the putative agent. Because the IgM molecule does not cross the placental barrier, any IgM would have to be of fetal origin and diagnostic of neonatal infection. Agents that are difficult to culture or those that adult females would be expected to have encountered during their lifetimes, such as Treponema pallidum, cytomegalovirus, herpes virus, Toxoplasma spp., or rubella virus, are organisms that may cause an infection and elevation of fetal IgM. The names of some of these agents have been grouped together with the acronym STORCH (syphilis, Toxoplasma spp., rubella, cytomegalovirus, and herpes). These tests should be ordered separately, depending on the clinical illness of a newborn suspected of having one of these diseases. In many instances, however, infected babies display no clinical signs or symptoms of infection. Furthermore, in many cases serologic tests yield false-positive or false-negative results. Therefore multiple considerations, including the patient history and the clinical signs and symptoms, must be included in the serodiagnosis of neonatal infection, and in many cases culture is still the most reliable diagnostic method.

Separating IgM from IgG for Serologic Testing Several methods have been developed to measure specific IgM in sera that may also contain IgG. In addition to using a labeled antibody specific for IgM as the marker or the IgM capture sandwich assays, the immunoglobulins can be separated from each other by physical means. Centrifugation through a sucrose gradient, performed at very high speeds, has been used in the past to separate IgM, which has a greater molecular weight than IgG. Other available IgM separation systems use the presence of certain proteins on the surface of staphylococci (protein A) and streptococci (protein G expressed by group C and G streptococci) that bind the Fc portion of IgG. A simple centrifugation step separates the particles and their bound immunoglobulins from the remaining mixture, which contains the bulk of the IgM. Other methods use antibodies to remove IgM from sera containing both IgG and IgM. An added bonus of IgM separation systems is that rheumatoid factor, IgM antibodies produced by some patients against their own IgG, often binds to the IgG molecules being removed from the serum. Consequently, these IgM antibodies are removed along with the IgG. Rheumatoid factor can cause nonspecific reactions and interfere with the results in a variety of serologic tests.

Principles of Immunochemical Methods Used for Organism Detection Numerous immunologic methods are used for the rapid detection of bacteria, fungi, parasites, and viruses in patient

150 PA RT I I   General Principles in Clinical Microbiology

specimens, and many of the same reagents often can be used to identify these organisms grown in culture. The immunochemical methods can be separated into a variety of general categories: precipitation tests, particle agglutination tests, flocculation, hemagglutination, immunofluorescence assays, enzyme immunoassay, and variations of each major technique.

Precipitation Tests The classic method of detecting soluble antigen and antibody (i.e., antigen and antibody in solution) is the Ouchterlony method, a double immunodiffusion precipitation method.

Double Immunodiffusion In the double immunodiffusion method (Ouchterlony gel diffusion), small circular wells are cut in an agarose gel, a gelatinlike matrix derived from agar, which is a chemical purified from the cell walls of brown algae. The agarose forms a porous material through which molecules can readily diffuse. For detection of antigens, the patient specimen is placed in a well, and antibody directed against the antigen is placed in the adjacent well. Over 18 to 24 hours, the antigen and antibody diffuse toward each other, producing a visible precipitin band (a lattice structure or visible band) at the point in the gel where the antigen and antibody are in equal proportion (zone of equivalence). If the concentration of antibody is significantly higher than that of the antigen, no lattice forms and no precipitation reaction occurs; this is known as prozone effect. Conversely, if excess antigen prevents lattice formation, resulting in no band formation, the effect is termed postzone. Immunodiffusion is currently used to detect exoantigens produced by the systemic fungi (Blastomyces dermatitidis, Coccidioides immitis, Coccidioides posadasii, Aspergillus spp., and Histoplasma capsulatum) or specific antibodies (Figure 9-6).

Single Immunodiffusion Single immunodiffusion, or Oudin gel diffusion, antibodies are added to a liquid agarose preparation and allowed to solidify in a petri dish, reaction cuvette, or tube. The patient’s sample containing the antigen is then added to a test well or added to the top of the gel in a tube and allowed to diffuse. As previously described with double immunodiffusion, when the zone of equivalence is reached, a visible precipitin band is formed, indicating a positive reaction. When a petri dish is used, the assay is considered a radial immunodiffusion that provides a means of semiquantification of the antigen in the patient’s sample. A set of standards containing known concentrations of antigen are also placed in wells within the same agarose plate. The samples diffuse radially from each well. The diameter of the precipitin ring is then measured and plotted against the known concentration of the standards, creating a standard curve. The patient’s sample ring is also measured, and using the standard curve, the amount of antigen in the sample can be determined.

• Figure 9-6  Exo-Antigen Identification System (Immuno-Mycologics, Inc., Norman, OK) The center well is filled with a 503 concentrate of an unknown mold. The arrow identifies well 1; wells 2 to 6 are shown clockwise. Wells 1, 3, and 5 are filled with anti-Histoplasma, antiBlastomyces, and anti-Coccidioides reference antisera, respectively. Wells 2, 4, and 6 are filled with Histoplasma antigen, Blastomyces antigen, and Coccidioides antigen, respectively. The unknown organism can be identified as Histoplasma capsulatum based on the formation of lines of identity (arc) linking the control bands with one or more bands formed between the unknown extract (center well) and the reference antiserum well (well 1).

Although immunodiffusion methods are relatively inexpensive and technically simple to perform and are highly specific, the interpretations are subjective. In addition, the assays demonstrate low sensitivity, making clinical utility questionable. Because of these disadvantages and the timeconsuming nature associated with immunodiffusion, use is limited to large reference laboratories and for educational purposes.

Particle Agglutination Numerous procedures have been developed to detect antigen by means of the agglutination (clumping) of an artificial carrier particle or insoluble matrix, such as a latex bead, with antibody bound to the surface (Figure 9-7). These assays are classified as indirect agglutination reactions, also referred to as reverse passive agglutination. In addition, agglutination assays that detect an intact antigen directly on an organism’s surface or cell are classified as direct agglutination assays. The assays use an inactivated whole organism mixed with patient serum to identify antibodies that indicate exposure to the infectious agent. Specific antibodies bind to surface antigens of the bacteria in a thick suspension and cause the bacteria to clump in visible aggregates. Such antibodies are called agglutinins, and the test is referred to as bacterial agglutination. Electrostatic and additional chemical interactions influence the formation of aggregates in solutions. Because most bacterial surfaces have a negative charge, they tend to repel each other. Performance of agglutination tests in sterile physiologic saline (0.9% sodium chloride in distilled water), which contains free positive ions, enhances the ability of antibody to cause aggregation

CHAPTER 9  Overview of Immunochemical Methods Used for Organism Detection

Latex beads

Specific antibody

Antigen

Particle agglutination

• Figure 9-7  Alignment of antibody molecules bound to the surface of a latex particle and latex agglutination reaction.

of bacteria. Although bacterial agglutination tests can be performed on the surface of plastic-coated reaction cards and in test tubes, tube agglutination tests, despite being more sensitive because a longer incubation period can be used, allowing more antigen and antibody to interact, are rarely used in the modern clinical laboratory. Examples of bacterial agglutination tests include assays for antibodies to Francisella tularensis and Brucella spp., which are part of a panel referred to as febrile agglutinin tests. Bacterial agglutination tests are often used to diagnose diseases in which the bacterial agent is difficult to cultivate in vitro. Diseases diagnosed by this technique include tetanus, yersiniosis, leptospirosis, brucellosis, and tularemia. The reagents necessary to perform many of these tests are commercially available, singly or as complete systems. Because most laboratories are able to culture and identify the causative agent, agglutination tests for certain diseases, such as typhoid fever, are seldom used today. Furthermore, the typhoid febrile agglutinin test (called the Widal test) is often positive in patients with infections caused by other bacteria because of cross-reacting antibodies or a previous immunization against typhoid. Appropriate specimens from patients suspected of having typhoid fever should be cultured for the presence of salmonellae. Whole cells of parasites, including Plasmodium spp., Leishmania spp., and Toxoplasma gondii, have also been used for direct detection of antibody by agglutination. In addition to using the actual infecting bacteria or parasites as the agglutinating particles, certain bacteria may be agglutinated by antibodies produced against another

151

infectious agent. Many patients infected with one of the rickettsiae produce antibodies capable of nonspecifically agglutinating bacteria of the genus Proteus, specifically Proteus vulgaris. The Weil-Felix test detects these crossreacting antibodies. Because newer, more specific serologic methods of diagnosing rickettsial disease have become more widely available, the use of the Proteus agglutinating test is no longer offered in many laboratories. The results of particle agglutination tests depend on several factors, including the amount and avidity of antigen conjugated to the carrier, the time of incubation with the patient’s serum (or other source of antibody), and the microenvironment of the interaction (including pH and protein concentration). In addition, some constituents of body fluids, such as rheumatoid factor or complement, have been found to cause false-positive reactions in latex agglutination systems. To counteract this problem, some agglutination methods require specimens to be pretreated by heating at 56°C or with ethylenediaminetetraacetic acid (EDTA) to inactivate complement proteins before testing. Commercial tests have been developed as systems, complete with their own diluents, controls, and containers. For accurate results, a serologic test kit should be used as a unit, without modification or mixing from another kit. In addition, tests developed for use with cerebrospinal fluid, for example, should not be used with serum unless the package insert or the technical representative has certified such use. Depending on the procedure, some reactions are reported as positive or negative and other reactions are graded on a 11 to 41 scale, with 21 usually the minimum amount of agglutination visible in a positive sample without the aid of a microscope. Control latex (coated with antibody from the same animal species from which the specific antibody was made) is tested alongside the test latex. If the patient specimen or the culture isolate reacts with both the test and control latex, the test is considered nonspecific and the results therefore are invalid. Latex tests are very popular in clinical laboratories for detecting antigen to Cryptococcus neoformans in cerebrospinal fluid or serum and to confirm the presence of betahemolytic streptococci from culture plates. Latex tests are continually being developed for a variety of organisms. Some examples of additional latex tests are available for the detection of Clostridium difficile toxins A and B, rotavirus, and Escherichia coli O157:H7.

Coagglutination Similar to latex agglutination, coagglutination uses antibody bound to a particle to enhance the visibility of the agglutination reaction between antigen and antibody. In this case the particles are killed and treated Staphylococcus aureus organisms (Cowan I strain), which contain a large amount of an antibody-binding protein, protein A, in their cell walls. In contrast to latex particles, these staphylococci bind only the base of the heavy chain portion of the antibody, leaving both antigen-binding ends free to form complexes with specific antigen (Figure 9-8). Several commercial suppliers have prepared

152 PA RT I I   General Principles in Clinical Microbiology

Protein A

Staphylococcus aureus (Cowan I strain)

Specific antibody

Antigen

viral particles, red blood cells, and patient serum. If the patient’s serum contains antibodies to the viral agent, hemagglutination is inhibited. In this method, no agglutination is considered a positive reaction. Influenzae virus is the most common infectious agent diagnosed using a hemagglutination inhibition assay. The most widely used indirect assays include the microhemagglutination test for antibody to T. pallidum (MHA-TP, so called because it is performed in a microtiter plate), the hemagglutination treponemal test for syphilis (HATTS), the passive hemagglutination tests for antibody to extracellular antigens of streptococci, and the rubella indirect hemagglutination tests, all of which are available commercially. Certain reference laboratories, such as the Centers for Disease Control and Prevention (CDC), also perform indirect hemagglutination tests for antibodies to some clostridia, Burkholderia pseudomallei, Bacillus anthracis, Corynebacterium diphtheriae, Leptospira spp., and the agents of several viral and parasitic diseases.

Hemagglutination Inhibition Assays

Particle agglutination

• Figure 9-8  Coagglutination.

coagglutination reagents for identification of streptococci, including Lancefield groups A, B, C, D, F, G, and N; Streptococcus pneumoniae; Neisseria meningitidis; and Haemophilus influenzae types A to F grown in culture. The coagglutination reaction is highly specific and demonstrates reduced sensitivity in comparison with commercially prepared latex agglutination systems.

Hemagglutination Hemagglutination, is the clumping of red blood cells, by either a direct or indirect mechanism. This type of agglutination reaction is used in immunohematology for blood group typing (direct) or the detection of a red cell antibody (indirect). Hemagglutination is also commonly used in virology. The monospot test is a hemagglutination assay that detects heterophile (nonspecific antibodies) produced in the early stages of infection with Epstein-Barr virus. More recently, indirect hemagglutination assays that use antigen from the infectious agent attached to a latex bead have been used to detect antibodies to human immunodeficiency virus (HIV), T. pallidum, and hepatitis viruses (A, B, and C). Another alternate method, termed hemagglutination inhibition, that takes advantage of hemagglutinating properties of viruses that cause hemagglutination in vivo, combine

Many human viruses can bind to surface structures on red blood cells from different species. For example, rubella virus particles can bind to human type O, goose, or chicken erythrocytes and cause agglutination of the red blood cells. Influenza and parainfluenza viruses agglutinate guinea pig, chicken, or human O erythrocytes; many arboviruses agglutinate goose red blood cells; adenoviruses agglutinate rat or rhesus monkey cells; mumps virus binds red blood cells of monkeys; and herpes virus and cytomegalovirus agglutinate sheep red blood cells. Serologic tests for the presence of antibodies to these viruses exploit the agglutinating properties of the virus particles. Patients’ sera that have been treated with kaolin or heparin-magnesium chloride (to remove nonspecific inhibitors of red cell agglutination and nonspecific agglutinins of the red cells) are added to a system containing the suspected virus. If antibodies to the virus are present, they form complexes and block the binding sites on the viral surfaces. When the proper red cells are added to the solution, all of the virus particles are bound by antibody, preventing the virus from agglutinating the red cells. Thus the patient’s serum is positive for hemagglutination-inhibiting antibodies. As for most serologic procedures, a fourfold increase in the titer is considered diagnostic. The hemagglutination inhibition tests for most agents are performed at reference laboratories. Rubella antibodies, however, are often detected with this method in routine diagnostic laboratories. Several commercial rubella hemagglutination inhibition test systems are available.

Flocculation Tests In contrast to the aggregates formed when particulate antigens bind to specific antibody, the interaction of soluble antigen with antibody may result in the formation of a precipitate, a concentration of fine particles, usually visible only because the precipitated product is forced to remain in

CHAPTER 9  Overview of Immunochemical Methods Used for Organism Detection

a defined space within a matrix. Variations of precipitation and flocculation are widely used for serologic studies. In flocculation tests the precipitin end product forms macroscopically or microscopically visible clumps. The Venereal Disease Research Laboratory test, known as the VDRL, is the most widely used flocculation test. Patients infected with pathogenic treponemes, most commonly T. pallidum, the agent of syphilis, form an antibodylike protein called reagin that binds to the test antigen, cardiolipin-lecithin–coated cholesterol particles, causing the particles to flocculate. Reagin is not a specific antibody directed against T. pallidum antigens; therefore the test is highly sensitive but not highly specific; however, it is a good screening test, detecting more than 99% of the cases of secondary syphilis. The VDRL is the single most useful test available for testing cerebrospinal fluid in cases of suspected neurosyphilis, although it may be falsely positive in the absence of disease. Performance of the VDRL test requires scrupulously clean glassware and attention to detail, including numerous daily quality control checks. In addition, the reagents must be prepared fresh immediately before the test is performed, and patients’ sera must be inactivated (complement inactivation) by heating for 30 minutes at 56°C before testing. Because of this complexity, the VDRL has been replaced in many laboratories by a qualitatively comparable test, the rapid plasma reagin (RPR) test. The RPR test is commercially available as a complete system containing positive and negative controls, the reaction card, and the prepared antigen suspension. The antigen, cardiolipin-lecithin–coated cholesterol with choline chloride, also contains charcoal particles to allow for macroscopically visible flocculation. Sera can be tested without heating, and the reaction takes place on the surface of a specially treated cardboard card, which is then discarded (Figure 9-9). The RPR test is not recommended for testing of cerebrospinal fluid. All procedures are standardized and clearly described in product inserts, and these procedures should be strictly

NR

NR

153

followed. Overall, the RPR appears to be a more specific screening test for syphilis than the VDRL, and it is not as technically complex. Several modifications have been made, such as the use of dyes to enhance visualization of results and the use of automated techniques. Conditions and infections other than syphilis can cause a patient’s serum to yield a positive result in the VDRL or RPR test; these are referred to as biologic false-positive tests. Autoimmune diseases, such as systemic lupus erythematosus and rheumatic fever, in addition to infectious mononucleosis, hepatitis, pregnancy, and old age, have been known to cause false-positive reactions. The results of screening tests should always be considered presumptive until confirmed with a specific treponemal test.

Neutralization Assays Antibody that inhibits the infectivity of a virus by blocking the host cell receptor site is called a neutralizing antibody. The test serum is mixed with a suspension of infectious viral particles of the same type as the virus suspected in a patient’s infection. A control suspension of viruses is mixed with normal serum. The viral suspensions are then inoculated into a cell culture system that supports growth of the virus. The control cells display evidence of viral infection. If the patient’s serum contains antibody to the virus, that antibody binds the viral particles and prevents them from invading the cells in culture; the antibody has neutralized the “infectivity” of the virus. These tests are technically demanding and time-consuming and are performed in reference laboratories. Antibodies to bacterial toxins and other extracellular products that display measurable activities can be tested in a similar fashion. The ability of a patient’s serum to neutralize the erythrocyte-lysing capability of streptolysin O, an extracellular enzyme produced by Streptococcus pyogenes during infection, has been used for many years as a test for identifying a previous streptococcal infection. After pharyngitis with streptolysin O–producing strains, most patients show a high titer of the antibody to streptolysin O (i.e., antistreptolysin O [ASO] antibody). Streptococci also produce the enzyme deoxyribonuclease B (DNase B) during infections of the throat, skin, or other tissue. A neutralization test that prevents activity of this enzyme, the anti–DNase B test, has also been used extensively as an indicator of recent or previous streptococcal disease. However, the use of particle agglutination tests (latex or indirect hemagglutination) for the presence of antibody to many of the streptococcal enzymes has replaced the use of these neutralization tests in many laboratories.

Complement Fixation Assays • Figure 9-9  MACRO-VUE rapid plasma reagin (RPR) card test. NR,

Nonreactive (negative test), indicated by a smooth suspension or nondiffuse slight roughness as demonstrated here as a peripheral roughness in well 1 or somewhat centric roughness in well 2; R, reactive (positive) test indicated by the diffuse degree of clumping. (Courtesy Becton Dickinson Diagnostic Systems, Sparks, Md.)

One of the classic methods of demonstrating the presence of antibody in a patient’s serum is the complement fixation (CF) test. This test consists of two separate systems. The first (the test system) consists of the antigen suspected of causing the patient’s disease and the patient’s serum. The second (the indicator system) consists of a combination of

154 PA RT I I   General Principles in Clinical Microbiology

sheep red blood cells, complement-fixing antibody (IgG) raised against the sheep red blood cells in another animal, and an exogenous source of complement (usually guinea pig serum). When these three components are mixed together in optimum concentrations, the antisheep erythrocyte antibody binds to the surface of the red blood cells, and the complement then binds to the antigen-antibody complex, ultimately causing lysis (bursting) of the red blood cells. For this reason the antisheep red blood cell antibody is also called hemolysin. For the CF test, these two systems are tested in sequence (Figure 9-10). The patient’s serum is first added to the putative antigen; then the limiting amount of complement is added to the solution. If the patient’s serum contains antibody to the antigen, the resulting antigenantibody complexes bind all the complement added. In the next step, the sheep red blood cells and the hemolysin (indicator system) are added. The patient’s complement is available to bind to the sheep cell–hemolysin complexes and cause lysis if the complement has not been bound by a complex formed with antibody from the patient’s serum. A positive result, meaning the patient has complement-fixing antibodies, is revealed by failure of the red blood cells to lyse in the final test system. Lysis of the indicator cells indicates lack of antibody and a negative CF test result. Although this test requires many manipulations, takes at least 48 hours to complete both stages, and often yields nonspecific results, it has been used for many years to detect many types of antibodies, particularly antiviral and antifungal antibodies. Many new systems have gradually been

introduced to replace the CF test, because they demonstrate improved recovery of pathogens or their products and provide more sensitive and less demanding procedures for detecting antibodies, such as particle agglutination, indirect fluorescent antibody tests, and enzyme-linked immunosorbent assay (ELISA). CF tests are performed chiefly for diagnosis of unusual infections.

Immunofluorescent Assays Immunofluorescent assays are frequently used for detecting bacterial and viral antigens in clinical laboratories. In these tests, antigens in the patient specimens are immobilized and fixed onto glass slides with formalin, methanol, ethanol, or acetone. Monoclonal or polyclonal antibodies conjugated (attached) to fluorescent dyes are applied to the specimen. After appropriate incubation, washing, and counterstaining (staining of the background with a nonspecific fluorescent stain such as rhodamine or Evan’s blue), the slide is viewed using a microscope equipped with a high-intensity light source (usually halogen) and filters to excite the fluorescent tag. Most kits used in clinical microbiology laboratories use fluorescein isothiocyanate (FITC) as the fluorescent dye. FITC fluoresces a bright apple-green (Figure 9-11). Fluorescent antibody tests are performed using either a direct fluorescent antibody (DFA) or an indirect fluorescent antibody (IFA) technique (Figure 9-12). In the DFA technique, FITC is conjugated directly to the specific anti­ body. In the IFA technique, the antigen-specific antibody

Negative result

RBCs

Positive result

Hemolysin Complement

RBC

Patient antibodies specific antigen

RBC RBCs

Complement

No complement Hemolysin (all bound up in Ag-Ab reaction)

Lysis

No lysis

• Figure 9-10  Complement fixation test.

CHAPTER 9  Overview of Immunochemical Methods Used for Organism Detection

• Figure 9-11  Legionella (direct) fluorescent test system (Scimedx Corp., Denville, NJ). Legionella pneumophila serogroup 1 in sputum.

Fluorescent label Primary antibody Antigen

Direct

Secondary antibody

Indirect

• Figure 9-12  Direct and indirect fluorescent antibody tests for antigen detection.

is unlabeled, and a second antibody (usually raised against the animal species from which the antigen-specific antibody was harvested) is conjugated to the FITC. The IFA is a two-step, or sandwich, technique. The IFA technique is more sensitive than the DFA method, although the DFA method is faster because it involves a single incubation. Indirect fluorescent antibody determination (IFA) is a widely applied method of detecting diverse antibodies. For

155

these types of tests, the antigen against which the patient makes antibody (e.g., whole Toxoplasma organisms or virus-infected tissue culture cells) is affixed to the surface of a microscope slide. The patient’s serum is diluted and placed on the slide, covering the area in which antigen was placed. If present in the serum, antibody binds to the specific antigen. Unbound antibody is then removed by washing the slide. In the second stage of the procedure, a conjugate of antihuman globulin directed specifically against IgG or IgM and a fluorescent dye (e.g., fluorescein) is placed on the slide. This labeled marker for human antibody binds to the antibody already bound to the antigen on the slide and serves as a detector, indicating binding of the antibody to the antigen when viewed under a fluorescent microscope (Figure 9-13). Commercially available test kits include slides coated with the antigen, positive and negative control sera, diluent for the patients’ sera, and the properly diluted conjugate. As with other commercial products, IFA systems should be used as units, without modification of the manufacturer’s instructions. Commercially available IFA tests include those for antibodies to Legionella spp., Borrelia burgdorferi, T. gondii, VZV, CMV, Epstein-Barr virus capsid antigen, early antigen and nuclear antigen, herpes simplex viruses (HSV) types 1 and 2, rubella virus, Mycoplasma pneumoniae, T. pallidum (the fluorescent treponemal antibody absorption test [FTA-ABS]), and several rickettsiae. Most of these tests, if performed properly, give extremely specific and sensitive results. Proper interpretation of IFA tests require experienced and technically competent technologists. These tests can be performed rapidly and are cost effective. The major advantage of immunofluorescent microscopy assays is the ability to visually assess the adequacy of a specimen. This is a major factor in tests for the identification of chlamydial elementary bodies or RSV antigens. Microbiologists can discern whether the specimen was collected from the columnar epithelial cells at the opening of the cervix in the case of the Chlamydia DFA test or from the basal cells of the nasal epithelium in the case of RSV. Reading immunofluorescent assays requires extensive training and practice for laboratory personnel to become proficient. Finally, fluorescent dyes fade rapidly over time, requiring digital imaging to maintain archives of the results. For this reason, some antibodies have been conjugated to other markers instead of fluorescent dyes. These colorimetric labels use enzymes, such as horseradish peroxidase, alkaline phosphatase, and avidinbiotin, to detect the presence of antigen by converting a colorless substrate to a colored end product. The advantage of these tags is that they allow the preparation of permanent mounts, because the reactions do not fade with storage, and visualization does not require a fluorescent microscope. In clinical specimens, fluorescent antibody tests are commonly used to detect infected cells that harbor Bordetella pertussis; T. pallidum; Legionella pneumophila; Giardia, Cryptosporidium, Pneumocystis, and Trichomonas spp.; HSV;

156 PA RT I I   General Principles in Clinical Microbiology

A

B • Figure 9-13  Indirect fluorescent antibody tests for Toxoplasma gondii, IgG antibodies. A, Positive reaction. B, Negative reaction. (Courtesy Meridian, Cincinnati, Ohio.)

CMV; VZV; RSV; adenovirus; influenza virus; and parainfluenza virus.

Enzyme Immunoassays Enzyme immunoassay (EIA), or enzyme-linked immunosorbent assay (ELISA), was developed during the 1960s. The basic method consists of antibodies bonded to enzymes; the enzymes remain able to catalyze a reaction, yielding a visually discernible end product while attached to the antibodies. Furthermore, the antibody binding sites remain free to react with their specific antigen. The use of enzymes as labels has several advantages. First, the enzyme itself is not changed during activity; it can catalyze the reaction of many substrate molecules, greatly amplifying the reaction and enhancing detection. Second, enzyme-conjugated antibodies are stable and can be stored for a relatively long time. Third, the formation of a colored end product allows direct observation of the reaction or automated spectrophotometric reading. The use of monoclonal antibodies has helped increase the specificity of currently available ELISA systems. New ELISA systems are continually being developed for the detection of etiologic agents or their products. In some instances, such as detection of RSV, HIV, and certain adenoviruses, ELISA systems may even be more sensitive than culture methods.

Solid-Phase Immunoassay Most ELISA systems developed to detect infectious agents consist of antibody firmly fixed to a solid matrix, either the inside of the wells of a microdilution tray or the outside of a spherical plastic or metal bead or some other solid matrix (Figure 9-14). Such systems are called solidphase immunosorbent assays (SPIA). If antigen is present in the specimen, stable antigen-antibody complexes form when the sample is added to the matrix. Unbound antigen is thoroughly removed by washing, and a second antibody against the antigen is then added to the system.

This antibody has been complexed to an enzyme such as alkaline phosphatase or horseradish peroxidase. If the antigen is present on the solid matrix, it binds the second antibody, forming a sandwich with antigen in the middle. After washing has removed unbound, labeled antibody, the addition and hydrolysis of the enzyme substrate causes the color change and completes the reaction. The visually detectable end point appears wherever the enzyme is present (Figure 9-15). Because of the expanding nature of the reaction, even minute amounts of antigen (greater than 1 ng/mL) can be detected. These systems require a specific enzyme–labeled antibody for each antigen tested. However, it is simpler to use an indirect assay in which a second, unlabeled antibody is used to bind to the antigenantibody complex on the matrix. A third antibody, labeled with enzyme and directed against the nonvariable Fc portion of the unlabeled second antibody, can then be used as the detection marker for many different antigen-antibody complexes (Figure 9-15). ELISA systems are important diagnostic tools for hepatitis Bs (surface) and hepatitis Be (early) antigens and HIV p24 protein, all indicators of early, active, acute infection.

Membrane-Bound Solid-Phase Enzyme Immunosorbent Assay The flow-through and large surface area characteristics of nitrocellulose, nylon, and other membranes have been exploited to enhance the speed and sensitivity of ELISA reactions. An absorbent material below the membrane pulls the liquid reactants through the membrane and helps to separate nonreacted components from the antigen-antibody complexes bound to the membrane; washing steps are also simplified. Membrane-bound SPIA systems are available for several viruses, group A betahemolytic streptococci antigen directly from throat swabs, and group B streptococcal antigen in vaginal secretions. In addition to their use in clinical laboratories, these assays are expected to become more prevalent for home testing systems.

CHAPTER 9  Overview of Immunochemical Methods Used for Organism Detection

Specific antibody

Antigen

157

Antigen Bead

Plastic well

Enzyme-conjugated antibody

Enzyme-conjugated antibody

Enzyme substrate

Enzyme substrate

Colored end product Colored end product

A

B • Figure 9-14  Principle of direct solid-phase enzyme immunosorbent assay (SPIA). A, The solid phase is the microtiter well. B, The solid phase is the bead.

Commercial microdilution or solid-phase matrix systems are available to detect antibody specific for hepatitis virus antigens, HSV 1 and 2, RSV, CMV, HIV, rubella virus (both IgG and IgM), mycoplasmas, chlamydiae, B. burgdorferi, Entamoeba histolytica, and many other agents. The introduction of membrane-bound ELISA components has improved sensitivity and ease of use dramatically.

Slot-blot and dot-blot assays force the target antigen through a membrane filter, causing it to become affixed in the shape of the hole (a dot or a slot). Several antigens can be placed on one membrane. When test (patient) serum is layered onto the membrane, specific antibodies, if present, bind to the corresponding dot or slot of antigen. Addition of a labeled second antibody and subsequent development of the label allows

158 PA RT I I   General Principles in Clinical Microbiology

Antigen Specific antibody Plastic well

Antibody capture ELISAs are particularly valuable for detecting IgM in the presence of IgG. Anti-IgM antibodies are fixed to the solid phase; therefore, only IgM antibodies, if present in the patient’s serum, are bound. In a second step, specific antigen is added in a sandwich format and a second antigen-specific labeled antibody is added. Toxoplasmosis, rubella, and other infections are diagnosed using this technology, typically in research settings.

Automated Fluorescent Immunoassays

Second antibody

In automated fluorescent immunoassays (FIA) the antigen is labeled with a compound that fluoresces under the appropriate light emission source. Binding of patient antibody to a fluorescent-labeled antigen can reduce or quench the fluorescence, or binding can cause fluorescence by allowing conformational change in a fluorescent molecule. Measurement of fluorescence is a direct measurement of antigen-antibody binding and is not dependent on a second marker, as in ELISA tests. Systems are commercially available to measure antibody developed against numerous infectious agents, as well as against self-antigens (autoimmune antibodies).

Western Blot Immunoassays Enzyme-conjugated third antibody

Substrate

Colored end product

• Figure 9-15  Principle of indirect solid-phase enzyme immunosorbent assay (SPIA).

visual detection of the presence of antibodies based on the pattern of antigen sites. Cassette-based membrane-bound ELISA assays, designed for testing a single serum, can be performed rapidly (often within 10 minutes). Commercial kits to detect antibodies to Helicobacter pylori, T. gondii, and some other infectious agents are available.

Requirements for the detection of very specific antibodies led to the development of the Western blot immunoassay (Figure 9-16). The method is based on the electrophoretic separation of major proteins of an infectious agent in a two-dimensional agarose (first dimension) and acrylamide (second dimension) matrix. A suspension of the organism is mechanically or chemically disrupted, and the solubilized antigen suspension is placed at one end of a polyacrylamide (polymer) gel. Under the influence of an electrical current, the proteins migrate through the gel. Most bacteria or viruses contain several major proteins that can be recognized based on their position in the gel after electrophoresis. Smaller proteins travel faster and migrate farther in the lanes of the gel. The protein bands are transferred from the gel to a nitrocellulose or other type of thin membrane, and the membrane is treated to immobilize the proteins. The membrane is then cut into many thin strips, each carrying the pattern of protein bands. When patient serum is layered over the strip, antibodies bind to each of the protein components represented by a band on the strip. The pattern of antibodies present can be used to determine whether the patient has a current infection or is immune to the agent (Figure 9-17). Antibodies against microbes with numerous cross-reacting antibodies, such as T. pallidum, B. burgdorferi, HSV 1 and 2, and HIV, are identified more specifically using this technology than a single method that is used to identify a single antibody type. For example, the CDC defines an ELISA or immunofluorescence assay as a first-line test for Lyme disease antibody, but "positive or equivocal results must be confirmed by a Western blot test.

CHAPTER 9  Overview of Immunochemical Methods Used for Organism Detection

A

B • Figure 9-16  Directigen respiratory syncytial virus (RSV) membrane-bound cassette. A, Positive reaction. B, Negative reaction (Courtesy Dickinson Diagnostic Systems, Sparks, Md.)

Protein solution + SDS

Infectious agent is

Lysate is

Iysed in solution with sodium dodecyl sulfate to release proteins.

placed into trough of polyacrylamide slab gel.

Electrophoresis results in separation of proteins based on molecular size and charge.

Polyacrylamide gel

Washing removes unbound nonspecific antibodies.

Antihuman antibody enzyme conjugate is added. Conjugate binds to antigenantibody complexes.

Substrate for the enzyme is added.

Patient serum

Patient serum is incubated with the nitrocellulose strip. Antibodies to the specific proteins, if present, bind to the appropriate z bands.

Wash to remove excess substrate

Nitrocellulose sheet is cut into strips.

Proteins are transferred onto a sheet of nitrocellulose.

Detection of specific antibody is based on enzyme-substrate colored reaction product, which occurs in a band pattern based on the position of the proteins on the strip.

Enzyme catalyzes production of colored product.

• Figure 9-17  Human immunodeficiency virus type 1 (HIV-1) Western blot immunoassay. Samples are

characterized as positive, indeterminate, or negative based on the bands found to be present in significant intensity. A positive blot has any two or more of the following bands: p24, gp41, and gp120/160. An indeterminate blot contains some bands but not the definitive ones. A negative blot has no bands present. Lane 16 shows antibodies from a control serum binding to the virus-specific proteins (p) and glycoproteins (gp) transferred onto the nitrocellulose paper. (Courtesy Calypte Biomedical Corp., Pleasanton, Calif.)

159

160 PA RT I I   General Principles in Clinical Microbiology

Summary

Bibliography

The immunochemical detection of microorganisms and other infectious agents is continually evolving. This chapter is intended to be a basic overview of some of the more common methods used in the direct detection of infectious agents or antibodies in a patient’s serum. Detailed information or application of immunochemical techniques are included in the organism-specific sections in Parts III through VI of this text.

Benjamini E, Sunshine G, Leskowitz S: Immunology: a short course, ed 6, New York, 1999, Wiley-Liss. Jesudason MV, Balajii V, Sirisinha S, Sridharan G: Rapid identification of Burkholderia pseudomallei in blood culture supernatants by coagglutination assay, Clin Microbiol Inf 11:930, 2005. Jorgensen J, Pfaller M, Carroll K, et al: Manual of clinical microbiology, ed 11, Washington, DC, 2015, ASM Press. Turgeon L: Immunology and Serology in Laboratory Medicine, ed 5, St Louis, Mo., 2013, Elsevier. Wee EJH, Lau HY, Botella JR, Trau M: Re-purposing bridging flocculation for on-site, rapid, qualitative DNA detection in resource poor settings, Chem Comm 51:5828, 2015.

Visit the Evolve site for a complete list of procedures, review questions, and case study answers.

SECTION 3   Evaluation of Antimicrobial Activity

10

Principles of Antimicrobial Action and Resistance

OBJECTIVES 1. List the five general categories of antimicrobial action. 2. Define antibiotic and antimicrobial. 3. Define and differentiate between bactericidal and bacteriostatic agents. 4. Compare and contrast the following terms: biologic versus clinical resistance, environmentally mediated versus microorganism-mediated resistance, and intrinsic versus acquired resistance. 5. Describe the basic structure and chemical principle for the mechanism of beta-lactam antimicrobials. 6. List common beta-lactam antibiotics and provide an example of a common pathogen susceptible to these agents. 7. Discuss two mechanisms of resistance both gram-positive and gram-negative bacteria use to decrease the effect of beta-lactam antibiotics. 8. Describe the chemical principle for the antimicrobial effects of glycopeptide agents. 9. List common glycopeptides and provide an example of a common pathogen susceptible to these agents. 10. List examples of cell membrane inhibitors, inhibitors of protein synthesis, inhibitors of deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) synthesis, and metabolic inhibitors. Provide an example of a common pathogen susceptible to each agent listed. 11. List five general mechanisms for antimicrobial resistance and provide at least one example of an antimicrobial agent that is known to be affected by each mechanism. 12. Describe how the spread of antimicrobial resistance affects diagnostic microbiology, including effects on sensitivity testing, therapeutic options, and organism identification.

M

edical intervention in an infection primarily involves attempts to eradicate the infecting pathogen using substances that actively inhibit or kill the organism. Some of these substances are obtained and purified from other microbial organisms and are known as antibiotics. Others are chemically synthesized. Collectively, these natural and synthesized substances are referred to as antimicrobial agents. Depending on the type of organisms targeted, these substances can be classified and described as antibacterial, antifungal, antiparasitic, or antiviral agents.

Because antimicrobial agents play a central role in the control and management of infectious diseases, understanding their mode of action and the mechanisms used by microorganisms to circumvent antimicrobial activity is important, especially because diagnostic laboratories are expected to design and implement tests that measure a pathogen’s response to antimicrobial activity (see Chapter 11). Much of what is discussed here regarding antimicrobial action and resistance is based on antibacterial agents, but the principles generally apply to almost all antiinfective agents. More information about antiparasitic, antifungal, and antiviral agents can be found in Parts IV, V, and VI, respectively.

Antimicrobial Action Principles Several key steps must be completed for an antimicrobial agent to successfully inhibit or kill an infecting microorganism (Figure 10-1). First, the agent must be in an active form. This is ensured through the pharmacodynamic design of the drug, which takes into account the route by which the patient receives the agent (e.g., orally, intramuscularly, intravenously). Second, the antibiotic must be able to achieve sufficient levels or concentrations at the site of infection so that it has a chance to exert an antibacterial effect (i.e., it must be in anatomic approximation with the infecting bacteria). The ability to achieve adequate levels depends on the pharmacokinetic properties of the agent, such as rate of absorption, distribution, metabolism, and excretion of the agent’s metabolites. Table 10-1 provides examples of various anatomic limitations characteristic of a few commonly used antibacterial agents. Some agents, such as ampicillin and ceftriaxone, achieve therapeutically effective levels in several body sites, whereas others, such as nitrofurantoin and norfloxacin, are limited to the urinary tract. Therefore knowledge of the site of infection can substantially affect the selection of the antimicrobial agent for therapeutic use. The remaining steps in antimicrobial action relate to direct interactions between the antibacterial agent and the bacterial cell. The antibiotic is attracted to and maintains contact with the cell surface. Because most targets of 161

162 PA RT I I  General Principles in Clinical Microbiology

D

D

D

D

D

D

D

D

D

1 Anatomic approximation

(Active drug)

2 Surface binding (adsorption)

Growth inhibition or Lysis and death

5

D

D

D D

D

4 Target binding

D

3 Intracellular uptake

• Figure 10-1  The basic steps required for antimicrobial activity and strategic points for bacterial circumvention or interference (X) of antimicrobial action, leading to resistance.

TABLE Anatomic Distribution of Some Common 10-1 Antibacterial Agents

bacterial growth, but generally do not kill the organism, are known as bacteriostatic agents. Effectively reducing the growth rate of an organism provides adequate protection in individuals whose immune system is capable of removing the agent of infection. Agents that usually kill target organisms are said to be bactericidal (Box 10-1). Bactericidal

Serum or Blood*

Cerebrospinal Fluid

Urine

Ampicillin

1

1

1

Ceftriaxone

1

1

1

Meropenem

1

1

1

Vancomycin

1

6

1

Ciprofloxacin

1

6

1

Generally Bacteriostatic

Gentamicin

1

2

1

Clindamycin

1

2

2

Norfloxacin

2

2

1

Nitrofurantoin

2

2

1

Chloramphenicol Erythromycin and other macrolides Clindamycin Sulfonamides Trimethoprim Tetracyclines Tigecycline Linezolid Quinupristin/dalfopristin

1, Therapeutic levels generally achievable at that site; 6, therapeutic achievable levels moderate to poor; 2, therapeutic levels generally not achievable at that site. *Serum or blood represents a general anatomic distribution.

antibacterial agents are intracellular, uptake of the antibiotic to some location inside the bacterial cell is required. Once the antibiotic has achieved sufficient intracellular concentration, binding to a specific target occurs. This binding involves molecular interactions between the antimicrobial agent and one or more biochemical components that play an important role in the microorganism’s cellular metabolism. Adequate binding of the target results in disruption of cellular processes, leading to cessation of bacterial cell growth and, depending on the antimicrobial agent’s mode of action, cell death. Antimicrobial agents that inhibit

• BOX 10-1 Bacteriostatic and Bactericidal

Antibacterial Agents*

Generally Bactericidal Aminoglycosides Beta-lactams Vancomycin Dalbavancin, Oritavancin, Telavancin Daptomycin Fosfomycin Tedizolid Teicoplanin (not FDA approved) Quinolones (e.g., ciprofloxacin, levofloxacin) Rifampin Metronidazole *The bactericidal and bacteriostatic nature of an antimicrobial may vary depending on the concentration of the agent used and the bacterial species targeted.

CHAPTER 10  Principles of Antimicrobial Action and Resistance

agents are more effective against organisms that are more difficult to control in combination with the host’s immune system. The primary goal in the development and design of antimicrobial agents is to optimize a drug’s ability to efficiently achieve all steps outlined in Figure 10-1 while minimizing toxic effects on human cells and physiology. Different antibacterial agents exhibit substantial specificity in terms of their bacterial cell targets—that is, their mode of action. For this reason, antimicrobial agents are frequently categorized according to their mode of action.

163

Mode of Action of Antibacterial Agents The interior of a bacterial cell has several potential antimicrobial targets. However, the processes or structures most frequently targeted are cell wall (peptidoglycan) synthesis, the cell membrane, protein synthesis, metabolic pathways, and DNA and RNA synthesis (Table 10-2).

Inhibitors of Cell Wall Synthesis The bacterial cell wall, also known as the peptidoglycan or murein layer, plays an essential role in the life of the bacterial

TABLE Summary of Mechanisms of Action for Commonly Used Antibacterial Agents 10-2

Antimicrobial Class

Mechanism of Action

Spectrum of Activity

Aminoglycosides (e.g., gentamicin, tobramycin, amikacin, streptomycin, kanamycin)

Inhibit protein synthesis by binding to 30S ribosomal subunit

Gram-positive and gram-negative bacteria; not anaerobes

Ansamycin (i.e., rifampin)

Inhibits RNA synthesis by binding DNA-dependent, RNA polymerase

Gram-positive and certain gram-negative (e.g., Neisseria meningitidis) bacteria

Beta-lactams (e.g., penicillin, ampicillin, piperacillin, cefazolin, cefotetan, ceftriaxone, cefotaxime, ceftazidime, ceftaroline, aztreonam, imipenem)

Inhibit cell wall synthesis by binding enzymes involved in peptidoglycan (PG) production (i.e., penicillin-binding proteins [PBPs])

Both gram-positive and gram-negative bacteria, but spectrum varies depending on individual antibiotic

Chloramphenicol

Inhibits protein synthesis by binding to 50S ribosomal subunit

Gram-positive and gram-negative bacteria

Folate pathway inhibitors (e.g., sulfonamides [S3], trimethoprim [T])

Interfere with folic acid pathway; S3 binds dihydropteroate synthase; T binds dihydrofolate reductase

Gram-positive and many gram-negative bacteria

Fluoroquinolones (e.g., ciprofloxacin, levofloxacin, norfloxacin, ofloxacin, pefloxacin)

Inhibit DNA synthesis by binding DNA gyrase and topoisomerase IV

Gram-positive and gram-negative bacteria; spectrum may vary with individual antibiotic

Glycopeptides (e.g., vancomycin) and lipoglycopeptides (e.g., dalbavancin, oritavancin, teicoplanin)

Inhibit cell wall synthesis by binding to end of PG, interfering with crosslinking

Gram-positive bacteria, including methicillinresistant Staphylococcus aureus

Glycylglycines (e.g., tigecycline)

Inhibition of protein synthesis by binding to 30S ribosomal subunit

Wide spectrum of gram-positive and gram-negative species, including those resistant to tetracycline

Ketolides (e.g., telithromycin)

Inhibition of protein synthesis by binding to 50S ribosomal subunit

Gram-positive cocci including certain macrolide-resistant strains and some fastidious gram-negative bacteria

Macrolide-lincosamide group (macrolides: e.g., erythromycin, azithromycin, clarithromycin; lincosamide: clindamycin)

Inhibition of protein synthesis by binding to 50S ribosomal subunit

Most aerobic and anaerobic gram-positive bacteria and atypical bacteria; clindamycin primarily for anaerobes

Lipopeptides (e.g., daptomycin)

Binding and disruption of cell membrane

Gram-positive bacteria, including those resistant to beta-lactams and glycopeptides

Nitrofurans (e.g., nitrofurantoin)

Exact mechanism uncertain; probable bacterial enzyme targets and direct DNA damage

Gram-positive and gram-negative bacteria; treatment of UTI only

Oxazolidinones (e.g., linezolid and tedizolid)

Bind to 50S ribosomal subunit to interfere with initiation of protein synthesis

Wide variety of gram-positive bacteria, including those resistant to other antimicrobials Continued

164 PA RT I I  General Principles in Clinical Microbiology

TABLE Summary of Mechanisms of Action for Commonly Used Antibacterial Agents—cont'd 10-2

Antimicrobial Class

Mechanism of Action

Spectrum of Activity

Polymyxins (e.g., polymyxin B and colistin)

Disruption of cell membrane

Gram-negative bacteria

Streptogramins (e.g., quinupristin/ dalfopristin)

Inhibit protein synthesis by binding to 2 sites on 50S ribosomal subunit

Primarily gram-positive bacteria

Tetracycline (e.g., doxycycline, minocycline, tetracycline)

Inhibits protein synthesis by binding to 30S ribosomal subunit

Gram-positive and gram-negative bacteria and several intracellular bacterial pathogens (e.g., chlamydia)

DNA, Deoxyribonucleic acid; RNA, ribonucleic acid; UTI, urinary tract infection.

cell. This fact, combined with the lack of a similar structure in human cells, has made the cell wall the focus of attention for the development of bactericidal agents that are relatively nontoxic for humans. Beta-Lactams

Beta-lactam antibiotics have a four-member, nitrogencontaining, beta-lactam ring at the core of their structure (Figure 10-2). The antibiotics differ in ring structure and β-lactam class Penicillins

Base molecular structure

Examples

Penicillin O Ampicillin Piperacillin R C NH Mezlocillin O

S N

CH3 CH3

COOH

Cephalosporins Cefazolin O Cefuroxime R C NH Cefotetan S Cefotaxime Ceftriaxone N CH2– R1 O Ceftazidime Cefepime COOH O R C NH Monobactams

Aztreonam O

N

SO3H

R Carbapenems

• Figure 10-2  Basic

Imipenem Meropenem Doripenem

R3 O

N COOH

structures and examples of commonly used beta-lactam antibiotics. The core beta-lactam ring is highlighted in yellow in each structure. (Modified from Salyers AA, Whitt DD, editors: Bacterial pathogenesis: a molecular approach, Washington, DC, 1994, ASM Press.)

attached chemical groups. This drug class comprises the largest group of antibacterial agents, and dozens of derivatives are available for clinical use. Types of beta-lactam agents include penicillins, cephalosporins, carbapenems, and monobactams. The popularity of these agents results from their bactericidal action and lack of toxicity to humans; also, their molecular structures can be manipulated to achieve greater activity for wider therapeutic applications. The beta-lactam ring is the key to the mode of action of these drugs. It is structurally similar to acyl-D-alanyl-Dalanine, the normal substrate required for synthesis of the linear glycopeptide in the bacterial cell wall. The betalactam binds the enzyme, inhibiting transpeptidation and cell wall synthesis. Most bacterial cells cannot survive once they have lost the capacity to produce and maintain their peptidoglycan layer. The enzymes essential for this function are anchored in the cell membrane and are referred to as penicillin-binding proteins (PBPs). Bacterial species may have four to six different types of PBPs. The PBPs involved in cell wall cross-linking (i.e., transpeptidases) are often the most critical for survival. When beta-lactams bind to these PBPs, cell wall synthesis is essentially halted. Death results from osmotic instability caused by faulty cell wall synthesis, or binding of the beta-lactam to PBP may trigger a series of events that leads to autolysis and cell death. Because nearly all clinically relevant bacteria have cell walls, beta-lactam agents act against a broad spectrum of gram-positive and gram-negative bacteria. However, because of differences among bacteria in their PBP content, natural structural characteristics (e.g., the outer membrane present in gram-negative but not gram-positive bacteria), and common antimicrobial resistance mechanisms, the effectiveness of beta-lactams against different types of bacteria can vary widely. Gram-positive bacteria secrete betalactamase into the environment, whereas beta-lactamases produced by gram-negative bacteria remain in the periplasmic space, providing increased protection from beta-lactam antimicrobials. In addition, any given beta-lactam drug has a specific group or type of bacteria against which it is considered to have the greatest activity. The type of bacteria against which a particular antimicrobial agent does and does

CHAPTER 10  Principles of Antimicrobial Action and Resistance

not have activity is referred to as that drug’s spectrum of activity. Many factors contribute to an antibiotic’s spectrum of activity, and knowledge of this spectrum is key to many aspects of antimicrobial use and laboratory testing. A common mechanism of bacterial resistance to betalactams is production of enzymes (i.e., beta-lactamases) that bind and hydrolyze these drugs. Just as there is a variety of beta-lactam antibiotics, there is a variety of beta-lactamases. The beta-lactamases are grouped into four major categories: classes A, B, C, and D. Classes A and D are considered serine peptidases; class C comprises cephalosporinases; and those in class B, which require zinc as a cofactor, are called metallo-beta-lactamases. Beta-lactamase genes can be located on plasmids or transposons, within an integron, or within the chromosome of the organism. An integron is a large cassette region that contains antibiotic resistance genes and the enzyme integrase, which is required for movement of the cassette from one genetic element to another. In addition, the antimicrobial may be constitutively produced or it may be induced by the presence of a beta-lactam agent. Of note, over the past decade carbapenem-resistant Enterobacteriaceae (CRE) isolates have emerged. The betalactamase enzymes they produce belong to group A (e.g., KPC, SME, IMI), B (e.g., VIM, IMP, NDM), or D (e.g., OXA-23, OXA-48). These beta-lactamases are encoded on mobile genetic elements that often harbor resistance genes to other groups of antibiotics, severely limiting therapeutic options. Bacteria normally susceptible to beta-lactams have developed several resistance mechanisms against these antimicrobials. Resistance mechanisms include genetic mutations in the PBP coding sequence, altering the structure and reducing the binding affinity to the drug; genetic recombination, resulting in a PBP structure resistant to binding of the drug; overproduction of normal PBP beyond achievable drug levels capable of inhibiting PBP activity; and acquiring a new genetic coding sequence for PBP from another organism with a lower affinity to the drug. These acquired types of beta-lactam resistance are more commonly found in grampositive bacteria. To circumvent the development of antimicrobial resistance, beta-lactam combinations comprising a beta-lactam with antimicrobial activity (e.g., ampicillin, amoxicillin, piperacillin, ceftazidime, ceftolozane) and a beta-lactam without activity capable of binding and inhibiting betalactamases (e.g., sulbactam, clavulanic acid, tazobactam, avibactam) have been developed. The binding beta-lactam “ties up” the beta-lactamases produced by the bacteria and allows the other beta-lactam in the combination to exert its antimicrobial effect. Examples of these beta-lactam/ beta-lactamase–inhibitor combinations include ampicillin/ sulbactam, amoxicillin/clavulanic acid, piperacillin/tazobactam, ticarcillin/clavulanic acid, ceftolozane/tazobactam, and ceftazidime/avibactam. Such combinations are effective only against organisms that produce beta-lactamases that are bound by the inhibitor; they have little effect on resistance that is mediated by altered PBPs (see Mechanisms of Antibiotic Resistance later in this chapter).

165

Fosfomycin

Fosfomycin tromethamine is a synthetic, phosphonic acid derivative that inhibits cell wall formation by inactivating enzymes involved in the first step of peptidoglycan synthesis. Currently it is approved in the United States as a single oral dose for uncomplicated urinary tract infections (UTIs) caused by susceptible strains of Enterococcus faecalis and Escherichia coli. Glycopeptides and Lipoglycopeptides

Glycopeptides are the other major class of antibiotics that inhibit bacterial cell wall synthesis by binding to the end of peptidoglycan (PG), interfering with transpeptidation. This is a different mechanism from that of the betalactams, which bind directly to the enzyme. Vancomycin (Figure 10-3) and teicoplanin are large molecules and function differently from beta-lactam antibiotics. With glycopeptides, the binding interferes with the ability of the PBP enzymes, such as transpeptidases and transglycosylases, to incorporate the precursors into the growing cell wall. With the cessation of cell wall synthesis, cell growth stops and death often follows. Because glycopeptides have a different mode of action, the resistance to beta-lactam agents by gram-positive bacteria does not generally hinder their activity. However, because of their relatively large size, they cannot penetrate the outer membrane of most gram-negative bacteria to reach their cell wall precursor targets. Therefore these agents are usually ineffective against gram-negative bacteria. Teicoplanin is approved for use throughout the world but is not available in the United States. If vancomycin is used for more than 3 days, the patient should be monitored for toxicity by obtaining a blood sample drawn within 30 minutes of the next dose (i.e., trough level). To

NH2 HO CH3 CH3 O O

CH3CH(CH3)2 OH Cl

HO OH OO CH2OH Cl

O

H

CO

H NHCO NHCH3 H

H NH CH2 CONH2

O

NHCO H NHCO H CO

H NH COOH HO H CONH OH

OH OH

OH

• Figure 10-3  Structure of vancomycin, a non–beta-lactam antibiotic

that inhibits cell wall synthesis. (Modified from Salyers AA, Whitt DD, editors: Bacterial pathogenesis: a molecular approach, Washington, DC, 1994, ASM Press.)

166 PA RT I I  General Principles in Clinical Microbiology

determine efficacy, blood can be drawn 30 minutes after the end of an infusion (i.e., peak level), or a single random level can be drawn 6 to 14 hours after the start of the infusion, because the drug should not accumulate. The lipoglycopeptides dalbavancin, oritavancin, and telavancin are structurally similar to vancomycin. These semisynthetic molecules are glycopeptides that contain hydrophobic chemical groups. The change in the molecular structure of lipoglycopeptides provides a mechanism by which they can bind to the bacterial cell membrane, increasing the inhibition of cell wall synthesis. In addition, the lipoglycopeptides increase cell permeability and cause depolarization of the cell membrane potential. These agents also inhibit the transglycosylation process necessary for cell wall synthesis by complexing with the D-alanyl-D-alanine residues. The lipoglycopeptides’ spectrum of activity is comparable with that of vancomycin but also includes vancomycin-intermediate Staphylococcus aureus (VISA). Several other cell wall–active antibiotics have been discovered and developed over the years, but toxicity to the human host has prevented their widespread clinical use. One example is bacitracin, which inhibits the recycling of certain metabolites required for maintaining peptidoglycan synthesis. Because of potential toxicity, bacitracin is only used as a topical antibacterial agent, and internal consumption is generally avoided.

Inhibitors of Cell Membrane Function Lipopeptides

The lipopeptide daptomycin exerts its antimicrobial effect by binding to and disrupting the cell membrane of grampositive bacteria. The drug binds to the cytoplasmic membrane and inserts its hydrophobic tail into the membrane, disrupting the cell membrane and increasing its permeability, which results in cell death. Daptomycin has potent activity against gram-positive cocci, including those resistant to other agents such as beta-lactams and glycopeptides (e.g., methicillinresistant S. aureus [MRSA], vancomycin-resistant enterococci [VRE], and vancomycin-resistant S. aureus [VRSA]). Because of its large size, daptomycin cannot penetrate the outer membrane of gram-negative bacilli and thus is ineffective against these organisms. Daptomycin should not be used to treat lung infections, because binding to lung surfactant inactivates the drug. On rare occasions this drug has caused eosinophilic allergic pneumonitis. Polymyxins (polymyxin B and colistin) are cyclic lipopeptide agents that disrupt bacterial cell membranes. The polymyxins act as detergents, interacting with phospholipids in the cell membranes to increase permeability. This disruption results in leakage of macromolecules and ions essential for cell survival. Because their effectiveness varies with the molecular makeup of the bacterial cell membrane, polymyxins are not equally effective against all bacteria. Most notably, they are most effective against gram-negative bacteria, whereas activity against gram-positive bacteria tends to be poor. Furthermore, human host cells also have membranes; therefore polymyxins pose a risk of toxicity.

The major side effects are neurotoxicity and nephrotoxicity. Although toxic, the polymyxins are often the antimicrobial agents of last resort when gram-negative bacilli (e.g., Pseudomonas aeruginosa, Acinetobacter spp.) that are resistant to all other available agents are encountered.

Inhibitors of Protein Synthesis Several classes of antibiotics target bacterial protein synthesis and severely disrupt cellular metabolism. Antibiotic classes that act by inhibiting protein synthesis include aminoglycosides, macrolide-lincosamide-streptogramins (MLS group), ketolides (e.g., telithromycin) chloramphenicol, tetracyclines, glycylglycines (e.g., tigecycline), and oxazolidinones (e.g., linezolid and tedizolid phosphate). Although these antibiotics are generally categorized as protein synthesis inhibitors, the specific mechanisms by which they inhibit protein synthesis differ significantly. Aminoglycosides

Aminoglycosides (aminoglycosidic aminocyclitol) inhibit bacterial protein synthesis by irreversibly binding to protein receptors on the organism’s 30S ribosomal subunit. This process interrupts several steps, including initial formation of the protein synthesis complex, accurate reading of the messenger RNA (mRNA) code, and formation of the ribosomal-mRNA complex. The structure of a commonly used aminoglycoside, gentamicin, is shown in Figure 10-4. Other aminoglycosides include tobramycin, amikacin, streptomycin, and kanamycin. The spectrum of activity of aminoglycosides includes a wide variety of aerobic gramnegative and certain gram-positive bacteria, such as S. aureus. Bacterial uptake of aminoglycosides is accomplished by using them in combination with cell wall–active antibiotics, such as beta-lactams or vancomycin. Anaerobic bacteria are unable to uptake these agents intracellularly and therefore

NH2

H2N

O

CH2OH

O H2N

OH

O O

OH HO OH

OH NHCH3

= Potential sites for acetylation = Potential sites for adenylylation or phosphorylation

• Figure 10-4  Structure of the commonly used aminoglycoside gentamicin. Potential sites of modification by adenylating, phosphorylating, and acetylating enzymes produced by bacteria are highlighted. (Modified from Salyers AA, Whitt DD, editors: Bacterial pathogenesis: a molecular approach, Washington, DC, 1994, ASM Press.)

CHAPTER 10  Principles of Antimicrobial Action and Resistance

are typically not inhibited by aminoglycosides. Levels of aminoglycosides in blood should be monitored during therapy to prevent nephrotoxicity and auditory or vestibular toxicity. Macrolide-Lincosamide-Streptogramin Group

The most commonly used antibiotics in the MLS group are the macrolides (e.g., erythromycin, azithromycin, clarithromycin, and clindamycin, which is a lincosamide). Protein synthesis is inhibited by drug binding to the 23S ribosomal RNA (rRNA) on the bacterial 50S ribosomal subunit and subsequent disruption of the growing peptide chain by blocking of translocation. Macrolides are generally bacteriostatic but may be bactericidal if the infective dose of the organism is low and the drug is used in high concentrations. Primarily because of uptake difficulties associated with the outer membranes of gram-negative bacteria, the macrolides and clindamycin are not effective against most genera of gram-negative organisms. However, they are effective against gram-positive bacteria, mycoplasmas, treponemes, and rickettsiae. Toxicity is generally low with macrolides, although hearing loss and reactions with other medications may occur. The lincosamides, clindamycin and lincomycin, bind to the 50S ribosomal subunit and prevent elongation by interfering with the peptidyl transfer during protein synthesis. They may exhibit bactericidal or bacteriostatic activity, depending on the bacterial species, size of the inoculum, and drug concentration. Lincosamides are effective against gram-positive cocci. However, clindamycin is most often used for treatment of anaerobic gram-positive bacteria and some anaerobic gram-negative bacteria. Warnings regarding increased risk of Clostridium difficile–associated disease (CDAD) after lincosamide use have been issued. Streptogramins are naturally occurring cyclic peptides that enter bacterial cells by passive diffusion and bind irreversibly to the 50S subunit of the bacterial ribosome, which induces a conformational change in the ribosome. The altered ribosome structure interferes with peptide bond formation during protein synthesis, disrupting elongation of the growing peptide. Streptogramins are able to enter most tissues and are effective against gram-positive and some gram-negative organisms. Quinupristin-dalfopristin is a dual streptogramin that targets two sites on the 50S ribosomal subunit. These drugs have low toxicity, with localized phlebitis as the major complication of intravenous infusion. Ketolides

The ketolide group of compounds consists of chemical derivatives of erythromycin A and other macrolides. As such, they act by binding to the 23S rRNA of the 50S ribosomal subunit, inhibiting protein synthesis. The key difference between the only currently available ketolide, telithromycin, and the macrolides is that telithromycin maintains activity against most macrolide-resistant gram-positive organisms and does not induce a common macrolide resistance mechanism (i.e., macrolide-lincosamide-streptogramin-B [MLSB] methylase), the alteration of the ribosomal target. Ketolides

167

are effective against respiratory pathogens and intracellular bacteria. The agents are particularly effective against grampositive and some gram-negative bacteria, as well as Mycoplasma, Mycobacteria, Chlamydia, and Rickettsia spp. and Francisella tularensis. Ketolides have low toxicity, and their major side effects are gastrointestinal symptoms, including diarrhea, nausea, and vomiting. Oxazolidinones

Oxazolidinones, represented by linezolid and tedizolid, are a relatively new class of synthetic antibacterial agents available for clinical use. These synthetic agents inhibit protein synthesis by specifically interacting with the 23S rRNA in the 50S ribosomal subunit, inhibiting 70S initiation complex formation and blocking translation of any mRNA, thereby preventing protein synthesis. Therefore these drugs are not expected to be affected by resistance mechanisms that affect other drug classes. Linezolid and tedizolid are effective against most gram-positive bacteria and mycobacteria. Toxicity is generally low, resulting in gastrointestinal symptoms, including diarrhea and nausea. Chloramphenicol

Chloramphenicol inhibits the addition of amino acids to the growing peptide chain by reversibly binding to the 50S ribosomal subunit, inhibiting transpeptidation. This antibiotic is highly active against a wide variety of gram-negative and gram-positive bacteria; however, its use is limited because of its toxicity and development of new effective and safer agents, mostly of the beta-lactam class. Bone marrow toxicity, which may result in aplastic anemia, is the major side effect associated with chloramphenicol treatment. Tetracyclines

The tetracyclines are considered broad-spectrum bacteriostatic antibiotics. They inhibit protein synthesis by binding reversibly to the 30S ribosomal subunit, interfering with the binding of the tRNA–amino acid complexes to the ribosome, preventing peptide chain elongation. Tetracyclines have a broad spectrum of activity that includes gramnegative bacteria, gram-positive bacteria, several intracellular bacterial pathogens (e.g., Chlamydia and Rickettsia spp.), and some protozoa. Infections caused by Neisseria gonorrhoeae, mycoplasma, and spirochetes may be successfully treated with these drugs. Toxicity includes upper gastrointestinal effects, such as esophageal ulcerations, nausea, vomiting, and epigastric distress. In addition, cutaneous phototoxicity may develop, resulting in disease, including photoallergic immune reactions. Glycylglycines

Glycylglycine agents are semisynthetic tetracycline derivatives. Tigecycline is the first agent of this class approved for clinical use. Similar to the tetracyclines, tigecycline inhibits protein synthesis by reversibly binding to the 30S ribosomal subunit. However, tigecycline has the advantage of being refractory to the most common tetracycline-resistance

168 PA RT I I  General Principles in Clinical Microbiology

mechanisms expressed by gram-negative and gram-positive bacteria. The most common side effects are nausea, vomiting, and diarrhea.

Inhibitors of Deoxyribonucleic Acid and Ribonucleic Acid Synthesis The primary antimicrobial agents that target DNA metabolism are the fluoroquinolones and metronidazole. Fluoroquinolones

Fluoroquinolones, also often simply referred to as quinolones, are derivatives of nalidixic acid, an older antibacterial agent. Commonly used fluoroquinolones include ciprofloxacin, levofloxacin, ofloxacin, norfloxacin (urinary tract only), and moxifloxacin. These agents bind to and interfere with DNA gyrase enzymes involved in the regulation of bacterial DNA supercoiling, a process essential for DNA replication, recombination, and repair. The newer fluoroquinolones also inhibit topoisomerase IV. Topoisomerase IV functions very similarly to DNA gyrase, unlinking DNA after replication. The fluoroquinolones are potent bactericidal agents and have a broad spectrum of activity that includes gram-negative and gram-positive organisms. The fluoroquinolones target DNA gyrase in gram-negative organisms and topoisomerase IV in gram-positive organisms. Because these agents interfere with DNA replication and therefore cell division, the drugs are bactericidal. However, the spectrum of activity and toxicity varies with the individual quinolone agent. Postmarketing reports from the Federal Food and Drug Administration (FDA) warn of tendinitis and rupture of the Achilles tendon associated with fluoroquinolone use in the general population, and the risk is greater in patients older than 60 years, those on concomitant steroid therapy, and transplant recipients.

Rifamycin

Rifamycins, which include the drug rifampin (also known as rifampicin), are semisynthetic antibiotics that bind to the enzyme DNA-dependent RNA polymerase and inhibit synthesis of RNA. Because rifampin does not effectively penetrate the outer membrane of most gram-negative bacteria, activity against these organisms is decreased compared with gram-positive bacteria. In addition, spontaneous mutation, resulting in the production of rifampin-insensitive RNA polymerases, occurs at a relatively high frequency. Therefore rifampin is typically used in combination with other antimicrobial agents (e.g., isoniazid and pyrazinamide for treatment of Mycobacterium tuberculosis). Rifampin’s side effects include gastrointestinal symptoms and hypersensitivity reactions.

Inhibitors of Other Metabolic Processes Antimicrobial agents that target bacterial processes other than those already discussed include sulfonamides, trimethoprim, and nitrofurantoin. Sulfonamides

The bacterial folic acid pathway produces precursors required for DNA synthesis (Figure 10-5). Sulfonamides target and bind to one of the enzymes, dihydropteroate synthase, and disrupt the folic acid pathway. Several different sulfonamide derivatives are available for clinical use. These agents are active against a wide variety of bacteria, including gram-positive and gram-negative (except P. aeruginosa) species. Sulfonamides are moderately toxic, causing vomiting, nausea, and hypersensitivity reactions. Sulfonamides are also antagonistic for several other medications, including warfarin, phenytoin, and oral hypoglycemic agents. p–Aminobenzoic acid (PABA)

Metronidazole

The exact mechanism of metronidazole’s antibacterial activity is related to the presence of a nitro group in the chemical structure. The nitro group is reduced by a nitroreductase in the bacterial cytoplasm, generating cytotoxic compounds and free radicals that disrupt the host DNA. Activation of metronidazole requires reduction under conditions of low redox potential, such as anaerobic environments. Therefore this agent is most potent against anaerobic and microaerophilic organisms, notably those that are gram negative. The drug is also effective in the treatment of protozoans, including Trichomonas and Giardia spp. and Entamoeba histolytica. Because susceptibility testing is not routinely performed on anaerobes, resistance is underreported. An emerging resistance to metronidazole (e.g., Clostridium difficile) is creating difficulties associated with bacterial diagnosis and treatment. Toxicity is low. Adverse side effects may include headache and mild gastrointestinal symptoms. Interaction with alcohol can lead to a disulfiram-like reaction, including vomiting, flushing, nausea, headache, and hypotension.

Sulfonamides (compete with PABA for enzyme)

Dihydropteroate synthase

Dyhydrofolic acid Dihydrofolate reductase

Trimethoprim

Tetrahydrofolic acid

Purines Other precursors DNA

• Figure 10-5  Bacterial

folic acid pathway indicating the target enzymes for sulfonamide and trimethoprim activity. (Modified from Katzung BG: Basic and clinical pharmacology, Norwalk, Conn, 1995, The McGraw-Hill Companies.)

CHAPTER 10  Principles of Antimicrobial Action and Resistance

Trimethoprim

Like the sulfonamides, trimethoprim targets the folic acid pathway. However, it inhibits a different enzyme, dihydrofolate reductase (Figure 10-5). Trimethoprim is active against several gram-positive and gram-negative species. Frequently, trimethoprim is combined with a sulfonamide (usually sulfamethoxazole) into a single formulation to produce an antibacterial agent that can simultaneously attack two targets in the same folic acid metabolic pathway. This drug combination can enhance activity against various bacteria and may help prevent the emergence of bacterial resistance to a single agent. Toxicity is typically mild. Adverse side effects include gastrointestinal symptoms and allergic skin rashes. Patients with acquired immunodeficiency syndrome (AIDS) are more likely to develop side effects than healthy individuals. Nitrofurantoin

Nitrofurantoin consists of a nitro group on a heterocyclic ring. The mechanism of action of nitrofurantoin is multifaceted. This agent may have several targets involved in bacterial protein and enzyme synthesis. Nitrofurantoin is converted by bacterial nitroreductases to reactive intermediates that bind bacterial ribosomal proteins and rRNA, disrupting synthesis of RNA, DNA, and proteins. Nitrofurantoin is used to treat uncomplicated urinary tract infections and has good activity against most gram-positive and gram-negative bacteria that cause infections at that site. Toxicity primarily consists of gastrointestinal symptoms, including diarrhea, nausea, and vomiting. Chronic pulmonary conditions may develop, including irreversible pulmonary fibrosis.

Mechanisms of Antibiotic Resistance Principles Successful bacterial resistance to antimicrobial action requires interruption or disturbance of one or more steps essential for effective antimicrobial action (Figure 10-1). These disturbances or resistance mechanisms can occur as a result of various processes, but the end result is partial or complete loss of antibiotic effectiveness. Different aspects of antimicrobial resistance mechanisms discussed include biologic versus clinical antimicrobial resistance, environmentally mediated antimicrobial resistance, and microorganism-mediated antimicrobial resistance.

Biologic Versus Clinical Resistance The development of bacterial resistance to antimicrobial agents to which they were originally susceptible requires alterations in the cell’s physiology or structure. Biologic resistance refers to changes that result in observably reduced susceptibility of an organism to a particular antimicrobial agent. When antimicrobial susceptibility has been lost to such an extent that the drug is no longer effective for clinical use, the organism has achieved clinical resistance.

169

It is important to note that biologic resistance and clinical resistance do not necessarily coincide. In fact, because most laboratory methods used to detect resistance focus on detecting clinical resistance, microorganisms may undergo substantial change in their levels of biologic resistance without notice. For example, for some time Streptococcus pneumoniae, a common cause of pneumonia and meningitis, was inhibited by penicillin at concentrations of 0.03 mg/mL or less. However, the clinical laboratory focused on detection of strains requiring 2 mg/mL of penicillin or more for inhibition as the defined threshold for resistance required for interference with effective treatment using penicillin. Although no isolates were being detected that required more than 2 mg/mL of penicillin for inhibition, strains were developing biologic resistance that required penicillin concentrations 10 to 50 times higher than 0.03 mg/mL for inhibition. From a clinical laboratory and public health perspective, it is important to realize that biologic development of antimicrobial resistance is an ongoing process. Our inability to reliably detect all these processes with current laboratory procedures and criteria should not be misinterpreted as evidence that no changes in biologic resistance are occurring.

Environmentally Mediated Antimicrobial Resistance Antimicrobial resistance is the result of nearly inseparable interactions involving the drug, the microorganism, and the environment in which they coexist. Characteristics of the antimicrobial agents, other than the mode and spectrum of activity, include important aspects of each drug’s pharmacologic attributes. However, these factors are beyond the scope of this text. Microorganism characteristics are discussed in subsequent sections of this chapter (see MicroorganismMediated Antimicrobial Resistance). The environmental effect on antimicrobial activity is considered here, and its importance cannot be overstated. Environmentally mediated resistance is defined as resistance directly resulting from physical or chemical characteristics of the environment that either directly alter the antimicrobial agent or alter the microorganism’s normal physiologic response to the drug. Examples of environmental factors that mediate resistance include pH, anaerobic atmosphere, cation concentrations, and thymidine content. Several antibiotics are affected by the pH of the environment. For instance, the antibacterial activities of erythromycin and aminoglycosides diminish with decreasing pH, whereas the activity of tetracycline decreases with increasing pH. Aminoglycoside-mediated shutdown of bacterial protein synthesis requires intracellular uptake across the cell membrane. Most of the aminoglycoside uptake is driven through oxidative processes in the cell. In the absence of oxygen, uptake (and hence the activity of the aminoglycoside) is substantially diminished. Aminoglycoside activity is also affected by the concentration of cations in the environment, such as calcium and magnesium (Ca21 and Mg21). This effect is most notable with

170 PA RT I I  General Principles in Clinical Microbiology

but rather are set to optimize detection of resistance expressed by microorganisms. Mg2+ — — — — — — P. aeruginosa — — — — — — —

2+ Mg2+ Ca Ca2+

Microorganism-mediated resistance refers to antimicrobial resistance that results from genetically encoded traits of the microorganism. Organism-based resistance can be divided into two subcategories, intrinsic (or inherent) resistance and acquired resistance.

AG ++

Intrinsic Resistance

Ca2+ Mg2+ AG ++ AG ++

AG ++ AG ++

Microorganism-Mediated Antimicrobial Resistance

• Figure 10-6  ​Cations (Mg21 and Ca21) and aminoglycosides (AG11) compete for the negatively charged binding sites on the outer membrane surface of Pseudomonas aeruginosa. Such competition is an example of the effect that environmental factors (e.g., cation concentrations) can have on the antibacterial activity of aminoglycosides.

P. aeruginosa. As shown in Figure 10-1, an important step in antimicrobial activity is the adsorption of the antibiotic to the bacterial cell surface. Aminoglycoside molecules have a net positive charge, and as is true for most gramnegative bacteria, the outer membrane of P. aeruginosa has a net negative charge. This electrostatic attraction facilitates attachment of the drug to the surface before internalization and subsequent inhibition of protein synthesis (Figure 10-6). However, calcium and magnesium cations compete with the aminoglycosides for negatively charged binding sites on the cell surface. If the positively charged calcium and magnesium ions outcompete aminoglycoside molecules for these sites, the amount of the drug taken up is decreased and antimicrobial activity is diminished. For this reason, aminoglycoside activity against P. aeruginosa decreases as environmental cation concentrations increase. The presence of certain metabolites or nutrients in the environment may also affect antimicrobial activity. For example, enterococci can use thymine and other exogenous folic acid metabolites to circumvent the activities of the sulfonamides and trimethoprim, which are folic acid pathway inhibitors (Figure 10-5). In essence, if the environment supplies other metabolites for the microorganism, the activities of antibiotics that target pathways for producing those metabolites are greatly reduced, if not entirely lost. In the absence of metabolites, full susceptibility to the antibiotics may be restored. Information about environmentally mediated resistance is used to establish standardized testing methods that minimize the effect of environmental factors, allowing more accurate determination of microorganism-mediated resistance mechanisms (see the following discussion). It is important to note that in vitro testing conditions are not established to re-create the in vivo physiology of infection,

Antimicrobial resistance resulting from the normal genetic, structural, or physiologic state of a microorganism is referred to as intrinsic resistance (Table 10-3). Such resistance is considered a natural and consistently inherited TABLE Examples of Intrinsic Resistance 10-3 to Antibacterial Agents

Natural Resistance

Mechanism

Anaerobic bacteria versus aminoglycosides

Lack of oxidative metabolism to drive uptake of aminoglycosides

Gram-positive bacteria versus aztreonam (beta-lactam)

Lack of penicillin-binding protein (PBP) targets that bind this beta-lactam antibiotic

Gram-negative bacteria versus vancomycin

Lack of uptake resulting from inability of vancomycin to penetrate outer membrane

Pseudomonas aeruginosa versus sulfonamides, trimethoprim, tetracycline, or chloramphenicol

Lack of uptake resulting in ineffective intracellular concentrations of these antimicrobials

Klebsiella spp. versus ampicillin (a betalactam) targets

Production of enzymes (betalactamases) that destroy ampicillin before it reaches its PBP target

Aerobic bacteria versus metronidazole

Inability to anaerobically reduce drug to its active form

Enterococci versus aminoglycosides

Lack of sufficient oxidative metabolism to drive uptake of aminoglycosides

Enterococci versus all cephalosporin antibiotics

Lack of PBPs that effectively bind and are inhibited by these beta-lactam agents

Lactobacilli and Leuconostoc spp. versus vancomycin

Lack of appropriate cell wall precursor target to bind vancomycin and inhibit cell wall synthesis

Stenotrophomonas maltophilia versus imipenem (beta-lactam)

Production of enzymes (betalactamases) that destroy imipenem before it reaches PBP targets

CHAPTER 10  Principles of Antimicrobial Action and Resistance

characteristic associated with the vast majority of strains in a particular bacterial group, genus, or species. Therefore this resistance pattern may be predictable and may lead to identification of the organism. Intrinsic resistance profiles are useful for determining which antimicrobial agents should be included in the battery of drugs tested against specific types of organisms. For example, referring to the information in Table 10-3, aztreonam would not be included in antibiotic batteries tested against gram-positive cocci. Similarly, vancomycin would not be routinely tested against gram-negative bacilli. As is discussed in Chapter 7, intrinsic resistance profiles are useful markers to aid in the identification of certain bacteria or bacterial groups.

Acquired Resistance Antibiotic resistance resulting from altered cellular physiology and structure caused by changes in a microorganism’s genetic makeup is known as acquired resistance. Unlike intrinsic resistance, acquired resistance may be a trait associated with specific strains of a particular organism group or species. Therefore the presence of this type of resistance in any clinical isolate is unpredictable. This unpredictability is the primary reason laboratory methods are necessary to detect resistance patterns (also known as antimicrobial susceptibility profiles) in clinical isolates. Because acquired resistance mechanisms are all genetically encoded, the methods for acquisition involve genetic change or exchange. Therefore resistance may be acquired by: • Successful genetic mutation • Acquisition of genes from other organisms via gene transfer mechanisms • A combination of mutational and gene transfer events

Common Pathways for Antimicrobial Resistance Whether resistance is intrinsic or acquired, bacteria share similar pathways or strategies to effect resistance to antimicrobial agents. Of the pathways listed in Figure 10-7, those that involve enzymatic destruction or alteration of the antibiotic, decreased intracellular uptake or accumulation of drug, and altered antibiotic target are the most common. One or more of these pathways may be expressed by a single cell successfully avoiding and protecting itself from the action of one or more antibiotics.

Resistance to Beta-Lactam Antibiotics As discussed earlier, bacterial resistance to beta-lactams may be mediated by enzymatic destruction of the antibiotics (beta-lactamase); altered antibiotic targets, resulting in low affinity or decreased binding of antibiotic to the target PBPs; or decreased intracellular uptake or increased cellular efflux of the drug (Table 10-4). All three pathways play an important role in clinically relevant antibacterial resistance, but bacterial destruction of beta-lactams through the production of beta-lactamases is by far the most common method of resistance. Extended-spectrum beta-lactamases are derived

Characteristics of intrinsic resistance

171

Characteristics of acquired resistance

Common pathways of resistance

1. Enzymatic degradation or modification of the antimicrobial agent 2. Decreased uptake or accumulation of the antimicrobial agent 3. Altered antimicrobial target 4. Circumvention of the consequences of antimicrobial action 5. Uncoupling of antimicrobial agent–target interactions and subsequent effects on bacterial metabolism 6. Any combination of mechanisms 1 through 5

• Figure 10-7  Overview of common pathways bacteria use to effect antimicrobial resistance.

from beta-lactamases and confer resistance to both penicillins and cephalosporins; carbapenemases are active against carbapenem drugs, such as imipenem. Beta-lactamases open the drug’s beta-lactam ring, and the altered structure prevents subsequent effective binding to PBPs; consequently, cell wall synthesis is able to continue (Figure 10-8). Staphylococci are the gram-positive bacteria that most commonly produce beta-lactamase; approximately 90% or more of clinical isolates are resistant to penicillin as a result of enzyme production. Rare isolates of enterococci also produce beta-lactamase. Gram-negative bacteria, including Enterobacteriaceae, P. aeruginosa, and Acinetobacter spp., produce dozens of different beta-lactamase types that mediate resistance to one or more of the beta-lactam antibiotics. Although the basic mechanism for beta-lactamase activity shown in Figure 10-8 is the same for all types of these enzymes, there are distinct differences. For example, betalactamases produced by gram-positive bacteria, such as staphylococci, are excreted into the surrounding environment, where the hydrolysis of beta-lactams takes place before the drug can bind to PBPs in the cell membrane (Figure 10-9). In contrast, beta-lactamases produced by gram-negative bacteria remain intracellular, in the periplasmic space, where they are strategically positioned to hydrolyze beta-lactams as they traverse the outer membrane through water-filled, protein-lined porin channels (Figure 10-9). Beta-­lactamases also vary in their spectrum of substrates; that is, not all beta-lactams are susceptible to hydrolysis by every beta-lactamase. For example, staphylococcal beta-lactamase can readily hydrolyze penicillin and penicillin derivatives (e.g., ampicillin, mezlocillin, and piperacillin); however, it cannot effectively hydrolyze many cephalosporins or imipenem. Various molecular alterations in the beta-lactam structure have been developed to protect the beta-lactam ring against enzymatic hydrolysis. This development has resulted in the

172 PA RT I I  General Principles in Clinical Microbiology

TABLE Summary of Resistance Mechanisms for Beta-Lactams, Vancomycin, Aminoglycosides, 10-4 and Fluoroquinolones

Antimicrobial Class Beta-lactams (e.g., penicillin, ampicillin, mezlocillin, piperacillin, cefazolin, cefuroxime, cefotetan, ceftazidime, aztreonam, imipenem)

Glycopeptides (e.g., vancomycin)

Aminoglycosides (e.g., gentamicin, tobramycin, amikacin, streptomycin, kanamycin)

Quinolones (e.g., ciprofloxacin, levofloxacin, norfloxacin, ofloxacin)

Macrolides (e.g., erythromycin, azithromycin, clarithromycin)

Resistance Pathway

Specific Mechanism

Examples

Enzymatic destruction

Beta-lactamase enzymes destroy betalactam ring, thus antibiotic cannot bind to penicillin-binding protein (PBP) and interfere with cell wall synthesis (see Figure 10-8).

Staphylococcal resistance to penicillin; resistance of Enterobacteriaceae and Pseudomonas aeruginosa to several penicillins, cephalosporins, and aztreonam

Altered target

Mutational changes in original PBPs or acquisition of different PBPs that do not bind beta-lactams sufficiently to inhibit cell wall synthesis (Figure 10-9).

Staphylococcal resistance to methicillin and other available beta-lactams Penicillin and cephalosporin resistance in S. pneumoniae and viridans streptococci

Decreased uptake

Porin channels (through which betalactams cross outer membrane to reach PBPs of gram-negative bacteria) change in number or character so that beta-lactam uptake is substantially reduced (Figure 10-9).

P. aeruginosa resistance to imipenem

Altered target

Alteration in the molecular structure of cell wall precursor components decreases binding of vancomycin, allowing cell wall synthesis to continue.

Enterococcal and Staphylococcus aureus resistance to vancomycin

Target overproduction

Excess peptidoglycan.

Vancomycin-intermediate staphylococci

Enzymatic modification

Modifying enzymes alter various sites on the aminoglycoside molecule; thus, ability of drug to bind to ribosome and halt protein synthesis is greatly diminished or lost.

Gram-positive and gram-negative resistance to aminoglycosides

Decreased uptake

Porin channels (through which aminoglycosides cross outer membrane to reach ribosomes of gram-negative bacteria) change in number or character so aminoglycoside uptake is substantially diminished.

Aminoglycoside resistance in a variety of gram-negative bacteria

Altered target

Mutational changes in ribosomal binding sites diminish ability of aminoglycoside to bind sufficiently and halt protein synthesis.

Enterococcal resistance to streptomycin (may also be mediated by enzymatic modifications)

Decreased uptake

Alterations in outer membrane diminish uptake of drug and/or activation of an “efflux” pump that removes quinolones before sufficient intracellular concentrations to inhibit DNA metabolism are achieved.

Gram-negative and staphylococcal (efflux mechanism only) resistance to various quinolones

Altered target

Changes in DNA gyrase subunits decrease ability of quinolones to bind this enzyme and interfere with DNA processes.

Gram-negative and gram-positive resistance to various quinolones

Efflux

Pumps drug out of cell before target binding.

Various streptococci and staphylococci

Altered target

Enzymatic alteration of ribosomal target reduces drug binding.

Various streptococci and staphylococci

DNA, Deoxyribonucleic acid; RNA, ribonucleic acid.

CHAPTER 10  Principles of Antimicrobial Action and Resistance

Beta-lactamase N

NH2

C

O

O

Unable to bind PBPs

OH

• Figure 10-8  Mode

of beta-lactamase enzyme activity. The enzyme cleaves the beta-lactam ring, and the molecule can no longer bind to penicillin-binding proteins (PBPs) and is no longer able to inhibit cell wall synthesis. (Modified from Salyers AA, Whitt DD, editors: Bacterial pathogenesis: a molecular approach, Washington, DC, 1994, ASM Press.)

production of more effective antibiotics in this class. For example, methicillin and the closely related agents oxacillin and nafcillin are molecular derivatives of penicillin that by the nature of their structure are not susceptible to staphylococcal beta-lactamases. These agents are the mainstay of antistaphylococcal therapy. Similar strategies have been applied to develop penicillins and cephalosporins that are more resistant to the variety of beta-lactamases produced by gram-negative bacilli. Even with this strategy, it is important to note that among common gram-negative bacilli (e.g., Enterobacteriaceae, P. aeruginosa, and Acinetobacter spp.), the list of molecular types Beta-lactams

Murein peptidoglycan layer

PBP

PBP

Penicillin-binding proteins (PBP) Cell membrane

2. Altered target –Staphylococci –Pneumococci –Enterococci

1. Beta-lactamase –Staphylococci –Enterococci

A

Beta-lactams Porins 1. Decreased uptake Outer membrane Periplasmic space

2. Beta-lactamases

Peptidoglycan layer PBP1

PBP2 Cell membrane Penicillin-binding proteins (PBP)

3. Altered target

Cytoplasm

B • Figure 10-9  Diagrammatic

173

summary of beta-lactam resistance mechanisms for gram-positive (A) and gram-negative (B) bacteria. A, Among gram-positive bacteria, resistance is mediated by (1) secretion of beta-lactamase that hydrolyzes beta-lactam antibiotic and (2) genetic mutation that produces an altered penicillin-binding protein (PBP) target that beta-lactam antibiotic does not bind. B, In gram-negative bacteria, resistance can also be mediated by (1) decreased uptake through the outer membrane porin channels, (2) membrane-bound beta-lactamase enzymes that hydrolyze beta-lactam antibiotic, and (3) genetic mutation that produces an altered PBP target that beta-lactam antibiotic does not bind or binds with lesser affinity.

174 PA RT I I  General Principles in Clinical Microbiology

and numbers of beta-lactamases continues to emerge and diverge, thus challenging the effectiveness of currently available beta-lactam agents. Another therapeutic strategy and area of active drug development has been to combine two different beta-lactam moieties. One of the beta-lactams (the beta-lactamase inhibitor) has little or no antibacterial activity but avidly and irreversibly binds to the beta-lactamase, rendering the enzyme incapable of hydrolysis; the second beta-lactam, which is susceptible to beta-lactamase activity, exerts its antibacterial activity. Examples of beta-lactam/beta-lactamase–inhibitor combinations include ampicillin/sulbactam, amoxicillin/clavulanic acid, ticarcillin/clavulanic acid, piperacillin/tazobactam, ceftolozane/ tazobactam, and ceftazidime-avibactam. Altered targets also play a key role in clinically relevant beta-lactam resistance (Table 10-4). Through this pathway the organism changes, or acquires from another organism, genes that encode altered cell wall–synthesizing enzymes (i.e., PBPs). These new PBPs continue their function even in the presence of a beta-lactam antibiotic, usually because the beta-lactam lacks sufficient affinity for the altered PBP. This is the mechanism by which staphylococci are resistant to methicillin and all other beta-lactams (e.g., cephalosporins and imipenem). Methicillin-resistant S. aureus produces an altered PBP called PBP2a. PBP2a is encoded by the gene mecA. Because of the decreased binding between betalactam agents and PBP2a, cell wall synthesis proceeds. Therefore strains exhibiting this mechanism of resistance must be challenged with a non–beta-lactam agent, such as vancomycin, another cell wall–active agent. Changes in PBPs are also responsible for ampicillin resistance in Enterococcus faecium and in the widespread beta-lactam resistance observed in S. pneumoniae and viridans streptococci. Because gram-positive bacteria do not have outer membranes through which beta-lactams must pass before reaching their PBP targets, decreased uptake is not a pathway for betalactam resistance among these bacteria. However, decreased uptake can contribute significantly to beta-lactam resistance in gram-negative bacteria (Figure 10-9). Changes in the number or characteristics of outer membrane porins through which betalactams pass contribute to absolute resistance (e.g., P. aeruginosa resistance to imipenem). In addition, porin changes combined with the presence of certain beta-lactamases in the periplasmic space may result in clinical resistance.

Resistance to Glycopeptides To date, acquired, high-level resistance to vancomycin has been commonly encountered among enterococci, rarely among staphylococci, and not at all among streptococci. The mechanism involves the production of altered cell wall precursors unable to bind vancomycin with sufficient avidity to allow inhibition of peptidoglycan-synthesizing enzymes. The altered targets are readily incorporated into the cell wall, allowing synthesis to progress (Table 10-4). A second mechanism of resistance to glycopeptides, described only among staphylococci to date, results in a lower level of resistance; this mechanism is thought to be mediated by

overproduction of the peptidoglycan layer, which binds excessive amounts of the glycopeptide molecule, reducing the ability of the drug to exert its antibacterial effect. Because enterococci have high-level vancomycin resistance genes and also the ability to exchange genetic information, the potential for spread of vancomycin resistance to other gram-positive genera poses a serious threat to public health. In fact, the emergence of vancomycin-resistant S. aureus clinical isolates has been documented. In all instances the patients were previously infected or colonized with enterococci. Resistance to vancomycin by enzymatic modification or destruction has not been described.

Resistance to Aminoglycosides Analogous to beta-lactam resistance, aminoglycoside resistance is accomplished by enzymatic, altered target, or decreased uptake pathways (Table 10-4). Gram-positive and gram-negative bacteria produce several different aminoglycoside-modifying enzymes. Three general types of enzymes catalyze one of the following modifications of an aminoglycoside molecule (Figure 10-4): • Phosphorylation of hydroxyl groups • Adenylation of hydroxyl groups • Acetylation of amine groups Once an aminoglycoside has been modified, its affinity for binding to the 30S ribosomal subunit may be sufficiently diminished or totally lost, allowing protein synthesis to occur. Aminoglycosides enter the gram-negative cell by passing through outer membrane porin channels. Therefore porin alterations can contribute to aminoglycoside resistance among these bacteria. Although some mutations resulting in altered ribosomal targets have been described, this mechanism of resistance is rare in bacteria exposed to commonly used aminoglycosides.

Resistance to Quinolones Enzymatic degradation or alteration of quinolones has not been described as a pathway for resistance. Resistance is most frequently mediated either by a decrease in uptake or in accumulation or by production of an altered target (Table 10-4). Components of the gram-negative cellular envelope can limit quinolone access to the cell’s interior location where DNA processing occurs. Other bacteria, notably staphylococci, exhibit a mechanism by which the drug is “pumped” out of the cell, thus keeping the intracellular quinolone concentration sufficiently low to allow DNA processing to continue relatively unaffected. This efflux process, therefore, is a pathway of reduced accumulation of drug rather than of decreased uptake. The primary quinolone resistance pathway involves mutational changes in the targeted subunits of the DNA gyrase. With a sufficient number or substantial major changes in molecular structure, the gyrase no longer binds quinolones, so DNA processing is able to continue.

Resistance to Other Antimicrobial Agents Bacterial resistance mechanisms for other antimicrobial agents involve modifications or derivations of the recurring

CHAPTER 10  Principles of Antimicrobial Action and Resistance

175

• BOX 10-2 Bacterial Resistance Mechanisms for

Miscellaneous Antimicrobial Agents

Chloramphenicol Enzymatic modification (chloramphenicol acetyltransferase) Decreased uptake

Mixing of the bacterial gene pool

Selective pressure from excessive antimicrobial use and abuse

Tetracyclines Diminished accumulation (efflux system) Altered or protected ribosomal target Enzymatic inactivation

Survival of the fittest

Macrolides (i.e., Erythromycin) and Clindamycin Altered ribosomal target Diminished accumulation (efflux system) Enzymatic modification

Sulfonamides and Trimethoprim

1. Emergence of “new” genes (e.g., methicillin-resistant staphylococci, vancomycin-resistant enterococci) 2. Spread of “old” genes to new hosts (e.g., penicillinresistant Neisseria gonorrhoeae)

Altered enzymatic targets (dihydropteroate synthase and dihydrofolate reductase for sulfonamides and trimethoprim, respectively) that no longer bind the antibiotic

3. Mutations of “old” genes resulting in more potent resistance (e.g., β-lactamase–mediated resistance to advanced cephalosporins in Escherichia coli and Klebsiella spp.)

Rifampin

4. Emergence of intrinsically resistant opportunistic bacteria (e.g., Stenotrophomonas maltophilia)

Altered enzyme (DNA-dependent RNA polymerase) target

• Figure 10-10  Factors contributing to the emergence and dissemination of antimicrobial resistance among bacteria.

pathway strategies of enzymatic activity, altered target, decreased uptake, or diminished accumulation (Box 10-2).

Emergence and Dissemination of Antimicrobial Resistance The resistance pathways that have been discussed are not necessarily new mechanisms that have recently evolved among bacteria. By definition, antibiotics originate from microorganisms. Therefore antibiotic resistance mechanisms have always been part of the evolution of bacteria as a means of survival among antibiotic-producing competitors. However, with the introduction of antibiotics into medical practice, clinically relevant bacteria have adopted resistance mechanisms as part of their survival strategy. As a result of the increased use of antimicrobial agents, a “survival of the fittest” strategy has been documented as bacteria adapt to the pressures of antimicrobial attack (Figure 10-10). All bacterial resistance strategies are encoded on one or more genes. These resistance genes are readily shared between strains of the same species, between species of different genera, and even between more distantly related bacteria. When a resistance mechanism arises, either by mutation or gene transfer, in a particular bacterial strain or species, it is possible for this mechanism to be passed on to other organisms using commonly described paths of genetic communication (Figure 2-10). Therefore resistance may spread to a wide variety of bacteria, and any single organism may acquire multiple genes and become resistant to the full spectrum of available antimicrobial agents. For example, strains of enterococci and P. aeruginosa already exist for which there are few effective therapeutic choices. Also, a gene encoding a single, very potent resistance mechanism may mediate

resistance to multiple antimicrobial agents. One such example is the mecA gene, which encodes staphylococcal resistance to methicillin and to all other beta-lactams currently available for use against these organisms; this leaves vancomycin as the only available and effective cell wall–inhibiting agent. In summary, antibiotic use, coupled with the formidable repertoire bacteria have for thwarting antimicrobial activity and their ability to genetically share these strategies, drives the ongoing process of emerging resistance (Figure 10-10). The constant development and spread of antimicrobial resistance is manifested in the emergence of new genes of unknown origin (e.g., methicillin-resistant staphylococci and vancomycin-resistant enterococci), the movement of old genes into new bacterial hosts (e.g., penicillin-resistant N. gonorrhoeae [PPNG]), mutations in familiar resistance genes that result in greater potency (e.g., beta-lactamase–mediated resistance to cephalosporins in Escherichia coli and other Enterobacteriaceae), and the emergence of new pathogens for which the most evident virulence factor is intrinsic or natural resistance to many of the antimicrobial agents used in the hospital setting (e.g., Stenotrophomonas maltophilia). Because of the ongoing nature of the emergence and dissemination of resistance, reliable laboratory procedures to detect drug resistance serve as crucial aids to managing patients’ infections and as a means of monitoring changing resistance trends among clinically relevant bacteria.

  Visit the Evolve site for a complete list of procedures, review questions, and case study answers.

176 PA RT I I  General Principles in Clinical Microbiology

CASE STUDY 10-1 A 40-year-old Michigan resident with diabetes, peripheral vascular disease, and chronic renal failure was receiving dialysis. The previous history was significant for multiple courses of antimicrobial therapy, including vancomycin, for the treatment of a chronic foot ulcer and methicillin-resistant Staphylococcus aureus (MRSA) bacteremia. A culture of the dialysis catheter site demonstrated growth of S. aureus. The isolate was resistant to oxacillin (minimum inhibitory concentration [MIC] greater than 16 mg/mL) and vancomycin (MIC greater than 128 mg/mL). A subsequent culture from the chronic foot ulcer revealed vancomycin-resistant S. aureus, vancomycin-resistant Enterococcus faecalis, and Klebsiella oxytoca.

Questions 1. Should the S. aureus isolate from the dialysis catheter site be reported as methicillin resistant? 2. What is the most likely mechanism by which the S. aureus isolate from the dialysis catheter site became resistant to vancomycin? 3. Which resistance pathway was most likely used by this S. aureus isolate? (Enzymatic destruction, altered target, decreased uptake, target overproduction, or efflux pump.)

Bibliography Bettiol E, Harbarth S: Development of new antibiotics: taking off finally? Swiss Med Wkly 145:w14167, 2015. Garau J: Other antimicrobials of interest in the era of extendedspectrum beta-lactamases: fosfomycin, nitrofurantoin and tigecycline, Clin Microbiol Infect 14:198, 2008. Jorgensen J: Manual of clinical microbiology, ed 11, Washington, DC, 2015, ASM Press. Kalogeropoulos A, Tsiodras S, Loverdos D, et al: Eosinophilic pneumonia associated with daptomycin: a case report and a review of the literature, J Med Case Reports 5:1752, 2011. Mayers DL: Antimicrobial drug resistance, vol 1, New York, 2009, Springer. Queenan A, Bush K: Carbapenemases: versatile b-lactamases. Clin Micro Rev 20:440, 2007.

Roberts KD, Azad MAK, Wang J, et al: Antimicrobial activity and toxicity of the major lipopeptide components of polymyxin B and colistin: last-line antibiotic against multidrug-resistant gramnegative bacteria. ACS Infect Dis 1:568-575, 2015. The Internet Drug Index. www.rxlist.com. Accessed June 22, 2016. U.S. Food & Drug Administration: Drugs. www.fda.gov/Drugs/ default.htm. Accessed June 22, 2016. Zhanel GG, Calic D, Schweizer F, et al: New lipoglycopeptides: a comparative review of dalbavancin, oritavancin, and telavancin, Drugs 70:860, 2010. Zhanel GG, Love R, Adam H, et al: Tedizolid: a novel oxazolidinone with potent activity against multidrug-resistant gram-positive pathogens. Drugs 75:253, 2015.

11

Laboratory Methods and Strategies for Antimicrobial Susceptibility Testing OBJECTIVES 1. List the relevant factors considered for control and standardization of antimicrobial susceptibility testing. 2. Explain how antimicrobial agents are selected for testing with regard to specimen source, site of infection, organism identity, and intrinsic resistance. 3. Discuss testing conditions (medium, inoculum size, incubation conditions, incubation duration, controls, and purpose) for the broth dilution, agar dilution, and disk diffusion methods and how results are affected if conditions are not well controlled. 4. Define a McFarland standard and explain how it is used to standardize susceptibility testing. 5. Describe how end points are determined for the broth dilution, agar dilution, and disk diffusion methods. 6. Define susceptible (S), intermediate (I), and resistant (R) interpretive categories of antimicrobial susceptibility testing. Also, discuss nuances of the categories of nonsusceptible (NS) and susceptible-dose dependent (SDD). 7. Define the minimal inhibitory concentration (MIC) break point and identify the types of testing used to determine a MIC. 8. Define peak and trough levels. Describe the data associated with peak and trough levels and discuss the clinical application.

A

s discussed in Chapter 10, most clinically relevant bacteria are capable of acquiring and expressing resistance to antimicrobial agents commonly used to treat infections. Therefore once an organism is isolated in the laboratory, characterization frequently includes tests to detect antimicrobial resistance. In addition to identifying the organism, the antimicrobial susceptibility profile often is a key component of the clinical laboratory report produced for the health care practitioner in charge of the patient’s care. The procedures used to produce antimicrobial susceptibility profiles and detect resistance to therapeutic agents are referred to as antimicrobial susceptibility testing (AST) methods. The methods applied for profiling aerobic and

9. Outline basic principles for agar screens, disk screens, and the “D” test for antimicrobial resistance detection in gram-positive bacteria, including methods and clinical use. 10. Explain the principle and purpose of the chromogenic cephalosporinase test. Name bacterial species and clinical situations in which this test may be useful. 11. Compare and contrast molecular methods to detect resistance mechanisms versus traditional susceptibility testing, including clinical utility, effectiveness, and specificity. 12. Explain the principles of the minimal bactericidal concentration, time-kill assay, serum bactericidal test, and synergy test and their clinical usefulness. 13. Contrast drug combination interaction terms: synergy, indifference, and antagonism. 14. Discuss the use of drug susceptibility testing as it relates to the use of predictor drugs (i.e., prototype agents) and organism identification. 15. List criteria for determining when to perform susceptibility testing. 16. Describe the importance of reviewing susceptibility profiles and provide examples of profiles that require further evaluation.

facultative anaerobic bacteria are the focus of this chapter; strategies for when and how these methods should be applied are also considered. Procedures for antimicrobial susceptibility testing of clinical isolates of anaerobic bacteria and mycobacteria are discussed in Chapters 40 and 42, respectively.

Goal and Limitations The primary goal of antimicrobial susceptibility testing is to determine whether the bacterial isolate is capable of expressing resistance to the antimicrobial agents selected for treatment. Because intrinsic resistance is usually known for most organisms, testing for intrinsic resistance is not necessary, 177

178 PA RT I I   General Principles in Clinical Microbiology

and organism identification is sufficient. In essence, antimicrobial susceptibility tests are assays designed to determine acquired resistance in any clinically important organism for which the antimicrobial susceptibility profile is unpredictable.

Standardization For laboratory tests to accurately determine organism-based resistance, the potential influence of environmental factors on antibiotic activity should be minimized (see Chapter 10). This does not mean that environmental resistance does not play a clinically relevant role; however, the major focus of the in vitro tests is to measure an organism’s expression of resistance. To control the impact of environmental factors, the conditions for susceptibility testing are extensively standardized. Standardization serves three important purposes: • It optimizes bacterial growth conditions so that inhibition of growth can be attributed to the antimicrobial agent against which the organism is being tested and is not the result of limitations of nutrients, temperature, or other environmental conditions that may hinder the organism’s growth. • It optimizes conditions for maintaining antimicrobial integrity and activity; thus failure to inhibit bacterial growth can be attributed to organism-associated resistance mechanisms rather than to environmental drug inactivation. • It maintains reproducibility and consistency in the resistance profile of an organism, regardless of the microbiology laboratory performing the test. Standard conditions for antimicrobial susceptibility testing methods have been established based on numerous laboratory investigations. The procedures, guidelines, and recommendations are published in documents from the Subcommittee on Antimicrobial Susceptibility Testing of the Clinical and Laboratory Standards Institute (CLSI). The CLSI documents that describe various methods of antimicrobial susceptibility testing are continuously updated and may be obtained by contacting CLSI, 950 W. Valley Road, Suite 2500, Wayne, Pa, 19087, or at http://www.clsi.org. The standardized components of antimicrobial susceptibility testing include: • Bacterial inoculum size • Growth medium (typically a Mueller-Hinton base) • pH • Cation concentration • Blood and serum supplements • Thymidine content • Incubation atmosphere • Incubation temperature • Incubation duration • Antimicrobial concentrations

Limitations of Standardization Although standardization of in vitro conditions is essential, the use of standard conditions has some limitations. Most

notably, the laboratory test conditions cannot reproduce the in vivo environment at the infection site where the antimicrobial agent and bacteria will actually interact. Factors such as the bacterial inoculum size, pH, cation concentration, and oxygen tension can differ substantially, depending on the site of infection. In addition, several other important factors play key roles in the patient outcome and are not taken into account by susceptibility testing. Some of these factors include: • Antibiotic diffusion into tissues and host cells • Serum protein binding of antimicrobial agents • Drug interactions and interference • Status of patient defense and immune systems • Multiple simultaneous illnesses • Virulence and pathogenicity of infecting bacterium • Site and severity of infection Despite these limitations, antimicrobial resistance can substantially alter the rates of morbidity and mortality in infected patients. Early and accurate recognition of resistant bacteria significantly aids the selection of antimicrobial therapy and optimal patient management. Thus in vitro susceptibility testing provides valuable data that are used in conjunction with other diagnostic information to guide patient therapeutic options. In addition, as discussed later in this chapter, in vitro susceptibility testing provides the data to track resistance trends among clinically relevant bacteria.

Testing Methods Principles Three general methods are available to detect and evaluate antimicrobial susceptibility: • Methods that directly measure the activity of one or more antimicrobial agents against a bacterial isolate • Methods that directly detect the presence of a specific resistance mechanism in a bacterial isolate • Special methods that measure complex antimicrobialorganism interactions The method used depends on factors such as clinical need, accuracy, and convenience. Given the complexities of antimicrobial resistance patterns, a laboratory may commonly use methods from more than one category.

Methods That Directly Measure Antimicrobial Activity Methods that directly measure antimicrobial activity involve bringing the antimicrobial agents of interest and the infecting bacterium together in the same in vitro environment to determine the effect of the drug’s presence on bacterial growth or viability. The level of effect on bacterial growth is measured, and the organism’s resistance or susceptibility to each agent is reported to the clinician. Direct measures of antimicrobial activity are accomplished using: • Conventional susceptibility testing methods such as broth dilution, agar dilution, and disk diffusion

CHAPTER 11  Laboratory Methods and Strategies for Antimicrobial Susceptibility Testing

179

• Commercial susceptibility testing systems • Special screens and indicator tests

Conventional Testing Methods: General Considerations Some general considerations apply to all three methods, including inoculum preparation and selection of antimicrobial agents. Inoculum Preparation

Properly prepared inocula are the key to any antimicrobial susceptibility testing method. Inconsistencies in inoculum preparation may lead to inconsistencies and inaccuracies in susceptibility test results. The two important requirements for correct inoculum preparation are use of a pure culture and use of a standard-sized inoculum. Interpretation of results obtained with a mixed culture is not reliable and can delay reporting of results. Pure inocula are obtained by selecting four or five colonies of the same morphology, inoculating them into a broth medium, and allowing the culture to achieve active growth (i.e., midlogarithmic phase), as indicated by observable turbidity in the broth. For most organisms this requires 3 to 5 hours of incubation. Alternatively, four to five colonies 16 to 24 hours of age may be selected from an agar plate and suspended in broth or 0.9% saline solution to achieve a turbid suspension. Currently many laboratories use a product, the BBL Prompt Inoculation system (BD Diagnostics, Sparks, MD), that allows direct standardization of the inoculum of rapidly growing bacteria without turbidity adjustment or preincubation. The system consists of an inoculation wand (a polypropylene rod with cross-hatched grooves on its end that hold a specific number of bacteria equivalent to 1.5 3 108 colony forming units [CFU] per milliliter) and a tube of saline. Five to ten isolated bacterial colonies are touched with the cross-hatched end of the wand, the collar on the wand is removed, and then the wand is placed into the saline tube and vortexed. Inocula should be used to inoculate AST plates within 6 hours. (See the package insert for more detailed information.) Use of a standard inoculum size is as important as culture purity and is accomplished by comparing the turbidity of the organism suspension with a turbidity standard. McFarland turbidity standards, prepared by mixing 1% sulfuric acid and 1.175% barium chloride to obtain a solution with a specific optical density, are commonly used. The 0.5 McFarland standard, which is commercially available, provides an optical density comparable to the density of a bacterial suspension of 1.5 3 108 CFU/mL. Pure cultures are grown or are prepared directly from agar plates to match the turbidity of the 0.5 McFarland standard (Figure 11-1). The newly inoculated bacterial suspension and McFarland standard are compared by examining turbidity against a dark background. Alternatively, any commercially available instruments capable of measuring turbidity may be used to standardize the inoculum. If the bacterial suspension does not match the standard’s turbidity, the suspension must be

• Figure 11-1  Bacterial suspension prepared to match the turbidity of

the 0.5 McFarland standard. Matching this turbidity provides a bacterial inoculum concentration of 1 to 2 3 108 CFU/mL. The McFarland standard on the right indicates the correct turbidity required for testing.

further diluted or supplemented with more organisms as needed. Selection of Antimicrobial Agents for Testing

The antimicrobial agents chosen for testing against a particular bacterial isolate are referred to as the antimicrobial battery or panel. A laboratory may use different testing batteries, but the content and application of each battery are based on specific criteria. Although the criteria listed in Box 11-1 influence the selection of the panel’s content, the final decision should not be made independently by the laboratory; input from the medical staff (particularly infectious diseases specialists) and pharmacists (e.g., a Pharmacy and Therapeutics committee) is imperative. CLSI publishes up-to-date tables listing potential antimicrobial agents (M100-S25) recommended for inclusion in batteries for testing against specific organisms or organism groups. Two tables are of particular interest: Table 1A, “Suggested Groupings of Antimicrobial Agents With US FDA Clinical Indications That Should Be Considered for Routine Testing and Reporting on Nonfastidious Organisms by Clinical Microbiology Laboratories,” and Table 1B, “Suggested Groupings of Antimicrobial Agents With US FDA Clinical Indications That Should Be Considered for Routine Testing and Reporting on Fastidious Organisms by Clinical Microbiology Laboratories.” A third table, Table 1C, lists suggested US Food and Drug Administration (FDA)–approved agents for testing and reporting on anaerobic organisms. Because revisions are made annually, laboratory protocols should be reviewed and modified accordingly (see the Bibliography).

180 PA RT I I   General Principles in Clinical Microbiology

• BOX 11-1

Criteria for Antimicrobial Battery Content and Use

Organism Identification or Group Antimicrobials to which the organism is intrinsically resistant are routinely excluded from the test battery (e.g., vancomycin versus gram-negative bacilli). Similarly, certain antimicrobials were developed specifically for use against particular organisms, but not against others (e.g., ceftazidime for use against Pseudomonas aeruginosa but not against Staphylococcus aureus); such agents should be included only in the appropriate battery.

Acquired Resistance Patterns Common to Local Microbial Flora If resistance to a particular agent is common, the utility of the agent may be sufficiently limited, and routine testing is not warranted. More potent antimicrobials are then included in the test battery. Conversely, more potent agents may not need to be in the test battery if susceptibility to less potent agents is highly prevalent.

Antimicrobial Susceptibility Testing Method Used Depending on the testing method, some agents do not reliably detect resistance and should not be included in the battery.

Site of Infection Some antimicrobial agents, such as nitrofurantoin, achieve effective levels only in the urinary tract and should not be included in batteries tested against bacterial isolates from other body sites (i.e., the agent must be able to achieve anatomic approximation; see Figure 11-1).

Availability of Antimicrobial Agents in the Formulary Antimicrobial test batteries are selected for their ability to detect bacterial resistance to agents used by the medical staff and accessible in the pharmacy.

Further considerations about antibiotics that may be used for a specific organism or group are presented later in this chapter and in various chapters in Part III of this text. Testing profiles are considered for each of the common organism groupings: • Enterobacteriaceae • Pseudomonas aeruginosa, Burkholderia cepacia, and Stenotrophomonas maltophilia • Acinetobacter spp. • Staphylococcus spp. • Enterococcus spp. • Streptococcus spp. (not including S. pneumoniae) • Streptococcus pneumoniae • Haemophilus influenzae • Neisseria gonorrhoeae

Conventional Testing Methods: Broth Dilution Broth dilution testing involves challenging the organism of interest with antimicrobial agents in a liquid environment. Each antimicrobial agent is tested using a range of concentrations, commonly expressed as micrograms (mg) of active drug per milliliter (mL) of broth (i.e., mg/mL).

The concentration range examined for a particular drug depends on specific criteria, including the safest therapeutic concentration possible in a patient’s serum. Therefore the concentration range examined often varies from one drug to the next, depending on the pharmacologic properties of the antimicrobial agent. In addition, the concentration range may be based on the level of drug required to reliably detect a particular resistance mechanism. In this case the test concentration for a drug may vary depending on the organism and its associated resistances. For example, to detect clinically significant resistance to cefepime in S. pneumoniae in cerebrospinal fluid isolates, the dilution scheme uses a maximum concentration of 2 mg/mL, whereas in nonmeningitis isolates, the maximum concentration used is 4 mg/mL. Moreover, for Escherichia coli the required maximum concentration to detect cefepime resistance is 16 mg/mL or higher. Typically, the range of concentrations examined for each antibiotic is a series of doubling dilutions (e.g., 16, 8, 4, 2, 1, 0.5, 0.25 mg/mL); the lowest antimicrobial concentration that completely inhibits visible bacterial growth, as detected visually or with an automated or semiautomated method, is recorded as the minimal inhibitory concentration (MIC). Procedures

The key features of broth dilution testing procedures are shown in Table 11-1. Because changes are made in these procedural recommendations, the CLSI M07 series “Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically,” should be consulted annually. Medium and Antimicrobial Agents.  With in vitro susceptibility testing methods, certain conditions must be altered when examining fastidious organisms to optimize growth and facilitate expression of bacterial resistance. For example, the Mueller-Hinton preparation is the standard medium used for most broth dilution testing, and conditions in the medium (e.g., pH, cation concentration, thymidine content) are well controlled by commercial manufacturers. However, media supplements or different media are required to obtain good growth and reliable susceptibility profiles for bacteria such as S. pneumoniae and H. influenzae. Although staphylococci are not considered fastidious organisms, media supplemented with sodium chloride (NaCl) enhances expression and detection of methicillinresistant isolates (Table 11-1). Broth dilution testing is divided into two general categories: microdilution and macrodilution. The principle of each test is the same; the only difference is the volume of broth in which the test is performed. For microdilution testing, the total broth volume is 0.05 to 0.1 mL; for macrodilution testing, the broth volumes are usually 1 mL or greater. Because most susceptibility test batteries require testing of several antibiotics at several different concentrations, the smaller volume used in microdilution allows this to be conveniently accomplished in a single microtiter tray (Figure 11-2).

CHAPTER 11  Laboratory Methods and Strategies for Antimicrobial Susceptibility Testing

181

TABLE Summary of Broth Dilution Susceptibility Testing Conditions 11-1

Incubation Conditions

Incubation Duration

5 3 105

35°C; room air

16-20 hr

CAMHB (plus 2% NaCl)

5 3 105

30°C-35°C; room air

16-20 hr (24 hr for meth-R)

Streptococcus pneumoniae and other streptococci

CAMHB plus 2%-5% lysed horse blood

5 3 105

35°C; room air

20-24 hr

Haemophilus influenzae

Haemophilus test medium

5 3 105

35°C; room air

20-24 hr

Neisseria meningitidis

CAMHB plus 2.5%-5% lysed horse blood

5 3 105

35°C; 5%-7% carbon dioxide (CO2)

20-24 hr

Organism Groups

Test Medium (Broth)

Enterobacteriaceae

Cation-adjusted MuellerHinton broth (CAMHB)

Staphylococci (to detect methicillin-resistance [meth-R])

Inoculum Size (CFU/mL)

CFU, Colony-forming units.

• Figure 11-2  Microtiter tray used for broth microdilution testing. Doubling dilutions of each antimicrobial agent in test broth occupies one vertical row (i.e., columns) of wells.

The need for multiple large test tubes in the macrodilution method makes that technique cumbersome and labor intensive when several bacterial isolates are tested simultaneously. For this reason, macrodilution is rarely used in most clinical laboratories, and subsequent discussion about broth dilution focuses on the microdilution approach. A key component of broth testing is proper preparation and dilution of the antimicrobial agents into the broth medium. Most laboratories that perform broth microdilution use commercially supplied microdilution panels in which the broth is already supplemented with appropriate antimicrobial concentrations. Therefore antimicrobial preparation and dilution are not commonly carried out in most clinical

laboratories (details of this procedure are outlined in the CLSI M07 document). In most instances, each antimicrobial agent is included in the microtiter trays as a series of doubling twofold dilutions. To ensure against loss of antibiotic potency, antibiotic microdilution panels are stored at 220°C or lower and thawed immediately before use. Once thawed the panels should never be refrozen, because substantial loss of antimicrobial action and potency can occur. Alternatively, the antimicrobial agents may be lyophilized or freeze-dried with the medium or drug in each well; upon inoculation with the bacterial suspension, the medium and drug are simultaneously reconstituted to appropriate concentrations.

182 PA RT I I   General Principles in Clinical Microbiology

Inoculation and Incubation.  Standardized bacterial suspensions that match the turbidity of the 0.5 McFarland standard (i.e., 1.5 3 108 CFU/mL) usually serve as the starting point for dilutions ultimately achieving the required final standard bacterial concentration of 5 3 105 CFU/mL in each microtiter well. It is essential to prepare the standard inoculum from a fresh, overnight, pure culture of the test organism. The microdilution panel is inoculated using manual or automated multiprong inoculators calibrated to deliver the precise volume of inoculum to each well in the panel simultaneously (Figure 11-2). Inoculated trays are incubated under optimal environmental conditions to optimize bacterial growth without interfering with the antimicrobial activity (i.e., avoiding environmentally mediated results). For the most commonly tested bacteria (e.g., Enterobacteriaceae, P. aeruginosa, staphylococci, and enterococci), the environmental condition consists of room air at 35°C (Table 11-1). Fastidious bacteria, such as H. influenza and Neisseria gonorrhoeae, require incubation in 5% to 10% carbon dioxide (CO2). Similarly, incubation durations for some organisms may need to be extended beyond the usual 16 to 20 hours (Table 11-1). However, prolonged incubation times beyond recommended limits should be avoided, because antimicrobial deterioration may result in false or elevated resistance patterns. This is a primary factor that limits the ability to perform accurate testing with some slow-growing bacteria.

Reading and Interpretation of Results.  After incubation, the microdilution trays are examined for bacterial growth. Each tray should include a growth (i.e., POS) control that does not contain antimicrobial agent and a sterility (i.e., NEG) control that was not inoculated. Once growth in the growth control and no growth in the sterility control wells have been confirmed, the growth profiles for each antimicrobial dilution can be established and the MIC determined. The detection of growth in microdilution wells is often augmented through the use of light boxes and reflecting mirrors. When a panel is placed in these devices, bacterial growth, manifested as light to heavy turbidity or a button of growth on the well bottom, is more reliably visualized (Figure 11-3). When the dilution series for each antibiotic is inspected, the microdilution well containing the lowest drug concentration that completely inhibits visible bacterial growth is recorded as the MIC. In Figure 11-3, the arrow indicates that the MIC for tetracycline (TE) is 4 mg/mL. Once the MICs for the antimicrobials in the test battery for an organism have been recorded, they are usually translated into one of three general interpretive categories, specifically susceptible (S), intermediate (I), or resistant (R), with recently added categories of nonsusceptible (NS) and susceptible dose-dependent (SDD) for specific situations (Box 11-2). The interpretive criteria for these categories are based on extensive studies that correlate the MIC with serumachievable levels for each antimicrobial agent, particular

• Figure 11-3  Bacterial growth profiles in a broth microdilution tray. Note the positive (POS) or growth control in the eleventh column of the bottom row and the negative (NEG) or sterility control in the twelfth column. The wells containing the lowest concentration of an antibiotic that completely inhibits visible growth (arrow) are recorded in micrograms per milliliter (mg/mL) as the minimal inhibitory concentration (MIC). In columns 1, 2, and 10 the MICs are as follows: 0.5, 4.0 (arrow), and 8 mg/mL, respectively. Growth is seen in all wells in columns 3 to 7 or 9; thus the MIC would be reported as being greater than the highest concentration tested. No growth is seen in any wells in columns 8, 11, and 12; thus the MIC would be reported as less than or equal to the lowest concentration of antibiotic tested.

CHAPTER 11  Laboratory Methods and Strategies for Antimicrobial Susceptibility Testing

• BOX 11-2 Definitions of Susceptibility Testing

Interpretive Categories

*

Susceptible (S) Indicates that the antimicrobial agent in question may be an appropriate choice for treating the infection caused by the organism. Bacterial resistance is absent or at a clinically insignificant level.

Susceptible-Dose Dependent (SDD) A new category that implies susceptibility of an isolate is dependent on dosing regimen and that altering dosing (e.g., higher doses, more frequent doses, or both) results in higher drug exposure than the dose that was used to establish the susceptible breakpoint. The concept of SDD has been included within the intermediate category definition. SDD is assigned when doses well above those used to calculate the susceptible breakpoint are approved and used clinically, and where sufficient data to justify the designation exist and have been reviewed.

Intermediate (I) Indicates a number of possibilities, including: • The potential utility of the antimicrobial agent in body sites where it may be concentrated (e.g., the urinary tract) or if high concentrations of the drug are used • Possible effectiveness of the antimicrobial agent against the isolate, but possibly less so than against a susceptible isolate • Use as an interpretive safety margin to prevent relatively small changes in test results from leading to major swings in interpretive category (e.g., resistant to susceptible or vice versa)

Resistant (R) Indicates that the antimicrobial agent in question may not be an appropriate choice for treatment, either because the organism is not inhibited with serum-achievable levels of the drug or because the test result highly correlates with a resistance mechanism that indicates questionable successful treatment.

Nonsusceptible (NS) Used for isolates for which only susceptible interpretive criterion has been established because of the absence or rare occurrences of resistant strains; antimicrobial agents with MICs above or zone diameters below the susceptible breakpoint should be reported as NS. Note: Confirmation of the organism’s identification and susceptibility test results should be performed. *Although these definitions are adapted from CLSI guidelines M7-A3 and M100-S25, they are commonly applied to results obtained by various susceptibility testing methods.

resistance mechanisms, and successful therapeutic outcomes. The interpretive criteria for an array of antimicrobial agents are published in the CLSI M07 series document “Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically (M100 supplements).” For example, using these standards, an isolate of P. aeruginosa with an imipenem MIC of less than or equal to 2 mg/mL would be classified as susceptible; one with an MIC of 4 mg/mL would be classified as intermediate; and one with an MIC of 8 mg/mL or greater would be classified as resistant to imipenem.

183

After the MICs are determined and their respective and appropriate interpretive categories assigned, the laboratory may report the MIC, the category, or both. Because the MIC alone will not provide most physicians with a meaningful interpretation of data, either the category result with or without the MIC is usually reported. In some settings, the full range of antimicrobial dilutions is not used; only concentrations that separate the categories of susceptible, intermediate, and resistant are used. The specific concentrations that separate or define the different categories are known as breakpoints, and panels that only contain these antimicrobial concentrations are referred to as breakpoint panels. In this case only interpretive category results are produced; precise MICs are not available, because the full range of dilutions is not tested. Recently the term epidemiologic cutoff value (ECV) has been introduced. The ECV has been proposed for certain bacterial isolates (e.g., Propionibacterium acnes and vancomycin) and may signal the emergence or evolution of nonwild type strains with acquired or mutational resistance (Table 2J-2, CLSI M100-S25). It is based on in vitro MIC data only, and the clinical relevance of ECV has yet to be proven. Advantages and Disadvantages.  Broth dilution methods provide data for both quantitative results (i.e., MIC) and qualitative results (i.e., category interpretation). Whether this is an advantage is a subject of debate. On one hand, the MIC can be helpful in establishing the level of resistance of a particular bacterial strain and can substantially affect the decision to treat a patient with a specific antimicrobial agent. For example, the penicillin MIC for S. pneumoniae may determine whether penicillin or alternative agents will be used to treat a patient with meningitis. On the other hand, for most antimicrobial susceptibility testing methods, a category report is sufficient and the actual MIC data are superfluous. This is one reason other methods (e.g., disk diffusion) that focus primarily on producing interpretive categories have been maintained among clinical microbiologists.

Conventional Testing Methods: Agar Dilution With agar dilution the antimicrobial concentrations and organisms to be tested are brought together on an agarbased medium rather than in liquid broth. Each doubling dilution of an antimicrobial agent is incorporated into a single agar plate; therefore, testing of a series of six dilutions of one drug requires the use of six plates, plus one positive growth control plate without antibiotic. The standard conditions and media for agar dilution testing are shown in Table 11-2. The surface of each plate is inoculated with 1 3 104 CFU (Figure 11-4). This method allows examination of one or more bacterial isolates per plate. After incubation the plates are examined for growth; the MIC is the lowest concentration of an antimicrobial agent in agar that completely inhibits visible growth. The same MIC breakpoints and interpretive categories used for broth dilution are applied for interpretation of agar dilution methods. Similarly, test

184 PA RT I I   General Principles in Clinical Microbiology

TABLE Summary of Agar Dilution Susceptibility Testing Conditions 11-2

Organism Groups

Test Medium (Agar)

Enterobacteriaceae

Mueller-Hinton Agar (MHA)

Enterococci (to detect vancomycinresistance)

Inoculum Size (CFU/spot)

Incubation Conditions

Incubation Duration

35°C; room air

16-20 hr

MHA (brain-heart infusion with 6 mg/mL vancomycin)

35°C; room air

24 hr

Staphylococci (to detect methicillinresistance)

MHA plus 2% NaCl

30°-35°C; room air

24 hr

Neisseria meningitidis

MHA plus 5% sheep blood

1 3 104

35°C; 5%-7% carbon dioxide (CO2)

20-24 hr

Streptococcus pneumoniae

Agar dilution not recommended; recent studies have not been performed or reviewed by CLSI subcommittee

Other streptococci

MHA plus 5% sheep blood; recent studies have not been performed or reviewed by CLSI subcommittee

1 3 104

35°C; air, CO2 may be needed for some isolates

20-24 hr

Neisseria gonorrhoeae

GC agar plus cysteine-free supplements

1 3 104

35°C; 5%-7% CO2

20-24 hr

1 3 104

CFU, Colony-forming units.

more fastidious organisms. In fact, one advantage of this method is that it provides a means for determining MICs for N. gonorrhoeae, which does not grow sufficiently in broth to be tested by broth dilution methods.

Conventional Testing Methods: Disk Diffusion

• Figure 11-4  Growth

pattern on an agar dilution plate. Each plate contains a single concentration of antibiotic. Growth is indicated by a spot on the agar surface. No spot is seen for isolates inhibited by the concentration of antibiotic incorporated into the agar of that particular plate.

results may be reported as the MICs only, the category only, or both. The preparation of agar dilution plates (see the CLSI M07 series document “Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically”) is sufficiently labor intensive to preclude use of this method in most clinical laboratories where multiple antimicrobial agents must be tested, even though several isolates may be tested per plate. As with broth dilution, the standard medium is the Mueller-Hinton preparation, but supplements and substitutions are made as needed to facilitate growth of

As more antimicrobial agents were created to treat bacterial infections, limitations of the macrodilution method became apparent. Before microdilution technology became widely available, it was clear that a more practical and convenient method of testing multiple antimicrobial agents against bacterial strains was needed. Out of this need the disk diffusion test was developed, emerging from the landmark study by Bauer et al. in 1966. These investigators standardized and correlated the use of antibiotic-impregnated filter paper disks (i.e., antibiotic disks) with MICs using many bacterial strains. The disk diffusion susceptibility test detects antimicrobial resistance by challenging bacterial isolates with antibiotic disks placed on the surface of an agar plate seeded with a lawn of the bacterial isolate being investigated (Figure 11-5). When disks containing a known concentration of an antimicrobial agent are placed on the surface of a freshly inoculated plate, the agent immediately begins to diffuse into the agar and establishes a concentration gradient around the paper disk. The highest concentration is closest to the disk. Upon incubation, the bacteria grow on the surface of the plate except where the antibiotic concentration in the gradient around each disk is sufficiently high to

CHAPTER 11  Laboratory Methods and Strategies for Antimicrobial Susceptibility Testing

A

185

B • Figure 11-5  A, Disk diffusion method: antibiotic disks are placed on the agar surface just after inoculation of the surface with the test organism. B, Zones of growth inhibition around various disks are apparent after 16 to 18 hours of incubation.

64

Resistant zone

Intermediate zone

Susceptible zone

32

MIC (µg/ml)

16 8 4 2 1.0 ≤ 0.5 6

10

15

20

25

30

35

Zone of inhibition surrounding disk (mm)

• Figure 11-6  Example of a regression analysis plot to establish zone-size breakpoints to define the cat-

egorical limits for susceptible, intermediate, and resistant for an antimicrobial agent. In this example, the maximum achievable serum concentration of the antibiotic is 8 mg/mL. Disk inhibition zones less than or equal to 18 mm in diameter indicate resistance; zones greater than or equal to 26 mm in diameter indicate susceptibility; the intermediate category is indicated by zones ranging from 19 to 25 mm in diameter. MIC, Minimum inhibitory concentration.

inhibit growth. After incubation, the diameter of the zone of inhibition around each disk is measured in millimeters (Figure 11-5). To establish reference inhibitory zone–size breakpoints to define the susceptible, intermediate, and resistant categories for each antimicrobial agent/bacterial species combination, hundreds of strains are tested. The inhibition zone sizes obtained are then correlated with MICs obtained by broth or agar dilution, and a regression analysis is completed comparing the zone size in millimeters (mm) against the MIC (Figure 11-6). As the MICs of the bacterial strains tested increase (i.e., the more resistant bacterial strains), the corresponding inhibition zone sizes (i.e., diameters) decrease. Using Figure 11-6 to illustrate, horizontal lines are

drawn from the MIC resistant breakpoint and the susceptible MIC breakpoint, 8 mg/mL and 2 mg/mL, respectively. Where the horizontal lines intersect the regression line, vertical lines are drawn to delineate the corresponding inhibitory zone–size breakpoints (in mm). Using this approach, zone size interpretive criteria have been established for most of the commonly tested antimicrobial agents and are published in the CLSI M02 series, “Performance Standards for Antimicrobial Disk Susceptibility Tests.” Procedures

The key features of disk diffusion testing procedures are summarized in Table 11-3; more details and updates are available through CLSI.

186 PA RT I I   General Principles in Clinical Microbiology

TABLE Summary of Disk Diffusion Susceptibility Testing Conditions 11-3

Test Medium (Agar)

Inoculum Size (CFU/mL)

Incubation Conditions

Incubation Duration

Enterobacteriaceae

Mueller-Hinton Agar (MHA)

Swab from 1.5 3 108 suspension

35°C; room air

16-18 hr

Pseudomonas aeruginosa

MHA

Swab from 1.5 3 108 suspension

35°C; room air

16-18 hr

Enterococci

MHA

Swab from 1.5 3 108 suspension

35°C; room air

16-18 hr (24 hr for vancomycin-R*)

Staphylococci (to detect methicillin-resistance)

MHA (add 2% NaCl for meth-R)

Swab from 1.5 3 108 suspension

30°-35°C; air (temp .35°C may mask meth-R)

16-18 hr (24 hr for meth-R and vancomycin-R*)

Streptococcus pneumoniae and other streptococci

MHA plus 5% sheep blood

Swab from 1.5 3 108 suspension

35°C; 5%-7% carbon dioxide (CO2)

20-24 hr

Haemophilus influenza

Haemophilus test medium

Swab from 1.5 3 108 suspension

35°C; 5%-7% CO2

16-18 hr

Neisseria gonorrhoeae

GC agar plus supplements

Swab from 1.5 3 108 suspension

35°C; 5%-7% CO2

20-24 hr

Organism Groups

CFU, Colony-forming units. *Methicillin (i.e., oxacillin) and vancomycin zone sizes should be read using transmitted light.

Medium and Antimicrobial Agents.  The Mueller-Hinton preparation is the standard agar-base medium used for testing most bacterial organisms, although certain supplements and substitutions are required for testing fastidious organisms. In addition to factors such as the pH and cation content, the depth of the agar medium can affect test accuracy and must be carefully controlled. Because antimicrobial agents diffuse in all directions from the surface of the agar plate, the thickness of the agar affects the antimicrobial drug concentration gradient. If the agar is too thick, the antimicrobial agent diffuses down through the agar as well as outward, resulting in smaller zone sizes, which may cause errors in interpretation (e.g., false-resistance); if the agar is too thin, the inhibition zones are larger, which may result in a false-susceptible interpretation. Most laboratories that perform disk diffusion testing purchase properly prepared and controlled Mueller-Hinton plates from reliable commercial vendors. The appropriate concentration of drug for each disk is predetermined and set by the FDA. The disks are available from various commercial sources and should be stored at the recommended temperature in a desiccator until use. Inappropriate storage can lead to deterioration of antimicrobial agents and cause misleading zone size results. To ensure equal diffusion of the drug into the agar, the disks must be placed flat on the surface and firmly applied to ensure adhesion. This is most easily accomplished by using any one of several disk dispensers available through commercial disk manufacturers. With these dispensers, all disks in the test battery are simultaneously delivered to the

inoculated agar surface and spaced to minimize the chances for inhibition zone overlap and significant interactions between antimicrobials. In most instances, a maximum of 12 antibiotic disks may be applied to the surface of a single 150-mm Mueller-Hinton agar plate (Figure 11-5). Inoculation and Incubation.  Before disk placement, the plate surface is inoculated using a swab that has been submerged in a bacterial suspension standardized to match the 0.5 McFarland turbidity standard, equivalent to 1.5 3 108 CFU/mL. The surface of the plate is swabbed in three directions to ensure even and complete distribution of the inoculum over the entire plate. Within 15 minutes of inoculation, the antimicrobial disks are applied and the plates are inverted for incubation to prevent the accumulation of moisture on the agar surface, which would interfere with the interpretation of test results. Most organisms are incubated at 35°C in ambient (i.e., room) air, but increased CO2 is used for testing of specific fastidious bacteria (see Table 11-3). Similarly, the incubation time may be increased beyond 16 hours to enhance detection of certain resistance patterns (e.g., methicillin resistance in staphylococci and vancomycin resistance in enterococci) and to ensure accurate results in general for fastidious organisms such as N. gonorrhoeae. The dynamics and timing of antimicrobial agent diffusion required for establishing a concentration gradient, in addition to growth of the organisms over 18 to 24 hours, are critical for reliable results. Therefore incubation of disk diffusion plates beyond the allotted time should be avoided. In general, disk diffusion is not an acceptable method for

CHAPTER 11  Laboratory Methods and Strategies for Antimicrobial Susceptibility Testing

testing slow-growing organisms requiring extended incubation, such as mycobacteria and anaerobes. Reading and Interpretation of Results. ​Before results with individual antimicrobial agent disks are read, the plate is examined to confirm that a confluent lawn of growth has been obtained (Figure 11-5). If growth between inhibitory zones around each disk is poor and nonconfluent, the test should not be interpreted and should be repeated. The lack of confluent growth may be due to insufficient inoculum. Alternatively, a particular isolate may have undergone mutation, and growth factors supplied by the standard medium are no longer sufficient to support robust growth. In the latter case, medium supplemented with blood and/or incubation in CO2 may enhance growth. However, caution in interpreting results is required when extraordinary measures are used to obtain good growth and the standard medium recommended for a particular type of organism is not used. Plates should also be examined for purity. Mixed cultures are evident through the appearance of different colony morphologies scattered throughout the lawn of bacteria (Figure 11-7). Mixed cultures require purification and repeat testing. A dark background and reflected light are used to examine disk diffusion plates (Figure 11-8). The plate is situated so that a ruler or caliper can be used to measure the inhibition zone diameters for each antimicrobial agent. Certain motile organisms, such as Proteus spp., may swarm over the surface of the plate and complicate clear interpretation of zone boundaries. In these cases, the swarming haze is ignored and zones are measured at the point where growth is obviously inhibited. Similarly, hazes of bacterial growth may be observed when testing sulfonamides and trimethoprim, because the organisms may go through several doubling generations before inhibition occurs; the resulting haze of growth should be ignored for interpretation of disk diffusion results with these agents. In instances not involving swarming organisms or the testing of sulfonamides and trimethoprim, hazes of growth

• Figure 11-7  A disk diffusion plate inoculated with a mixed culture, as

evidenced by the various colonial morphologies (arrows) appearing throughout the lawn of growth.

187

Reflected light

Transmitted light

• Figure 11-8  Examination of a disk diffusion plate by transmitted and

reflected light.

that occur in more obvious inhibition zones should not be ignored. In many instances, this is the only way clinically relevant resistance patterns are manifested by certain bacterial isolates using the disk diffusion method. Key examples in which this may occur include cephalosporin resistance among several species of Enterobacteriaceae, methicillin resistance in staphylococci, and vancomycin resistance in some enterococci. In fact, the haze produced by some staphylococci and enterococci is best detected using transmitted rather than reflected light. In these cases, the disk diffusion plates are held in front of the light source when reading methicillin- and vancomycin-inhibition zones (Figure 11-8). Still other significant resistances may appear as individual colonies in an obvious zone of inhibition (Figure 11-9).

• Figure 11-9  Bacterial growth is visible inside the zone of inhibition (arrows). This may indicate inoculation with a mixed culture. However, emergence of resistant mutants of the test isolate is a more likely reason for this growth pattern.

188 PA RT I I   General Principles in Clinical Microbiology

When such colonies are seen, purity of the test isolate must be confirmed. If purity is confirmed, the individual colonies are considered variants or resistant mutants of the same species, and the test isolate should be considered resistant. Once zone sizes have been recorded, interpretive categories are assigned. Interpretive criteria for antimicrobial agent/organism combinations that may be tested by disk diffusion are provided in the annual CLSI-M02 series and M100 supplement (to be used with M02, M07, and M011 documents). The definitions of susceptible, intermediate, and resistant are the same as those used for dilution methods (Box 11-2). For example, using the CLSI interpretive standards, an E. coli isolate that produces an ampicillin inhibition zone diameter of 13 mm or less is classified as resistant; if the zone is 14 to 16 mm, the isolate is considered intermediate to ampicillin; if the zone is 17 mm or greater, the organism is categorized as susceptible. Unlike MICs, inhibition-zone sizes are used to produce a category interpretation and have no clinical utility. Therefore when testing is performed by disk diffusion, only the category interpretation of susceptible, intermediate, or resistant is reported. Advantages and Disadvantages.  Two important advantages of the disk diffusion test are convenience and user friendliness. Up to 12 antimicrobial agents can be tested against one bacterial isolate with minimal use of extra materials and devices. Because the results are generally accurate for commonly encountered bacteria, the disk diffusion technique is still among the most frequently used methods for antimicrobial susceptibility testing. The major disadvantages of this method are lack of interpretive criteria for organisms not included in Table 11-3 and the inability to provide more precise data (e.g., MIC value) about the level of an organism’s resistance or susceptibility.

Commercial Susceptibility Testing Systems The variety and widespread use of commercial susceptibility testing methods reflect the key role resistance detection plays in the responsibilities of clinical microbiology laboratories. In many instances, the commercial methods are variations of the conventional dilution or disk diffusion methods, and their accuracies have been evaluated by comparison of results with those obtained by conventional methods. In addition, many of the media and environmental conditions standardized for conventional methods are maintained with the use of commercial systems. The goal of detecting resistance is the same for all commercial methods, but the principles and practices vary with respect to: • The format in which bacteria and antimicrobial agents are brought together • The extent of automation for inoculation, incubation, interpretation, and reporting • The method used for detection of bacterial growth inhibition • The speed with which results are produced • Accuracy

Accuracy is an extremely important aspect of any susceptibility testing system and is addressed in more detail later in this chapter. Broth Microdilution Methods

Several systems have been developed that provide microdilution panels already prepared and formatted according to the guidelines for conventional broth microdilution methods (e.g., BBL Sceptor, BD Microbiology Systems, Cockeysville, MD; Sensititre, Trek Diagnostics Systems, Inc., Oakwood Village, OH; MicroScan touch SCAN-SR, Beckman Coulter, Inc., Brea, CA). These systems enable laboratories to perform broth microdilution without having to prepare their own panels. The systems may differ to some extent regarding the volume in the test wells, how inocula are prepared and added, the availability of different supplements for the testing of fastidious bacteria, the types of antimicrobial agents and dilution schemes, and the format of medium and antimicrobial agents (e.g., dry-lyophilized or frozen). Furthermore, the degree of automation for inoculation of the panels and devices available for reading results vary among the different products. In general, these commercial panels are designed to receive the standard inoculum and are incubated using conditions and durations recommended for conventional broth microdilution. They are growth-based systems that require overnight incubation, and CLSI interpretive criteria apply for interpretation of most results. Reading of these panels is commonly augmented by semiautomated reading devices. Agar Dilution Derivations

One commercial system (Spiral Biotech Inc., Advanced Instruments, Inc., Norwood, MA) uses an instrument to apply the antimicrobial agent to the surface of an alreadyprepared agar plate in a concentric spiral fashion. Starting in the center of the plate, the instrument deposits the highest concentration of antibiotic, and from that point drug application proceeds to the periphery of the plate. Diffusion of the drug in the agar establishes a concentration gradient from high (center of plate) to low (periphery of plate). Starting at the periphery of the plate, bacterial inocula are applied as a single streak perpendicular to the established gradient in a spoke-wheel fashion. After incubation, the distance is measured between the point where growth is noted at the edge of the plate to the point where growth is inhibited toward the center of the plate. This value is used to calculate the MIC for the antimicrobial agent against each of the bacterial isolates on the plate. Diffusion in Agar Derivations

One test has been developed that combines the convenience of disk diffusion with the ability to generate MIC data. The Etest (bioMérieux, Durham, NC) uses plastic strips; one side of the strip contains the antimicrobial agent concentration gradient, and the other contains a numeric scale that indicates the drug concentration (Figure 11-10). Mueller-Hinton

CHAPTER 11  Laboratory Methods and Strategies for Antimicrobial Susceptibility Testing

189

A

B • Figure 11-10  The Etest strip uses the principle of a predefined antibiotic gradient on a plastic strip to generate a MIC value. It is processed in the same way as the disk diffusion. A, Individual antibiotic strips are placed on an inoculated agar surface. B, After incubation, the MIC is read where the growth/inhibition edge intersects the strip graduated with an MIC scale across 15 dilutions (arrow). Several antibiotic strips can be tested on a plate. (Courtesy bioMérieux, Marcy l’Etoile, France.)

plates are inoculated as for disk diffusion, and the strips are placed on the inoculum lawn. Several strips may be placed radially on the same plate so that multiple antimicrobials may be tested against a single isolate. After overnight incubation, the plate is examined and the number present at the point where the border of growth inhibition intersects the E-strip is taken as the MIC (Figure 11-10). The same MIC interpretive criteria used for dilution methods, as provided in CLSI guidelines, are used with the E-test value to assign an interpretive category of susceptible, intermediate, or resistant. This method provides a means of producing MIC data in situations in which the level of resistance can be clinically relevant (e.g., penicillin or cephalosporins against S. pneumoniae). Another method (BIOMIC, Giles Scientific, Inc., Santa Barbara, CA) combines the use of conventional disk diffusion methodology with video digital analysis to automate

interpretation of inhibition-zone sizes. Automated zone readings and interpretations are combined with computer software to produce MIC values and to allow data manipulations for detecting unusual resistance profiles and producing antibiogram reports. Automated Antimicrobial Susceptibility Test Systems

The automated antimicrobial susceptibility test systems available for use in the United States include the Vitek Legacy and Vitek 2 systems (bioMérieux, Inc., Durham, NC), the MicroScan WalkAway system (Beckman Coulter, Inc., Brea, CA), and the Phoenix system (BD Microbiology Systems, Sparks, MD). These different systems vary with respect to the extent of automation of inoculum preparation and inoculation, the methods used to detect growth, and the algorithms used to interpret and assign MIC values

190 PA RT I I   General Principles in Clinical Microbiology

and categorical findings (i.e., susceptible, intermediate, or resistant). For example, the Vitek 2 AST inoculum is automatically introduced by a filling tube into a miniaturized, plastic, 64-well, closed card containing specified concentrations of antibiotics (Figure 11-11). Cards are incubated

• Figure 11-11  The VITEK 2 antimicrobial susceptibility test card contains 64 wells with multiple concentrations of up to 22 antibiotics. The antibiotic is rehydrated when the organism suspension is introduced into the card during the automated filling process. (Courtesy bioMérieux, Marcy l’Etoile, France.)

in a temperature-controlled compartment. Optical readings are performed every 15 minutes to measure the light transmitted through each well, including a growth control well. Algorithmic analysis of the growth kinetics in each well is performed by the system’s software to derive the MIC data. The MIC results are validated with the Advanced Expert System (AES) software, a category interpretation is assigned, and the organism’s antimicrobial resistance patterns are reported. Resistance detection is enhanced with the sophisticated AES software, which can recognize and report resistance patterns using MICs. In summary, this system facilitates standardized susceptibility testing in a closed environment with validated results and recognition of an organism’s antimicrobial resistance mechanism in 6 to 8 hours for most clinically relevant bacteria (Figure 11-12). The MicroScan WalkAway system uses the broth microdilution panel format manually inoculated with a multiprong device. Inoculated panels are placed in an incubator-reader unit, where they are incubated for the required time, and then the growth patterns are automatically read and interpreted. Depending on the microdilution tray used, bacterial growth may be detected using spectrophotometry or fluorometry (Figure 11-13). Spectrophotometric analyzed panels require overnight incubation, and the growth patterns may be read manually

A

B • Figure 11-12  The components of the VITEK 2 system consist of the instrument housing; the sample

processor and reader/incubator; the computer workstation, which provides data analysis, storage, and epidemiology reports; the Smart Carrier Station, which is the direct interface between the microbiologist on the bench and the instrument; and a bar code scanner to facilitate data entry. (Courtesy bioMérieux, Marcy l’Etoile, France.)

CHAPTER 11  Laboratory Methods and Strategies for Antimicrobial Susceptibility Testing

A

191

B • Figure 11-13  Microdilution tray format (A) used with the MicroScan WalkAway instrument (B) for automated incubation, reading, and interpretation of antimicrobial susceptibility tests. (Courtesy Beckman Coulter, Inc., Brea, CA.)

as described for routine microdilution testing. Fluorometric analysis is based on the degradation of fluorogenic substrates by viable bacteria. The fluorogenic approach can provide susceptibility results in 3.5 to 5.5 hours. Either full dilution schemes or breakpoint panels are available. In addition to speed and facilitation of workflow, the automated systems provide increasingly powerful computer-based data management that can be used to evaluate the accuracy of results, manage larger databases, and interface with the pharmacy to improve and advance the utility of antimicrobial susceptibility testing data. The Phoenix system provides a convenient, albeit manual, gravity-based inoculation process. Growth is monitored in an automated fashion based on a redox indicator system, with results available in 8 to 12 hours. Supplemental testing (e.g., confirmatory extended-spectrum beta-lactamase [ESBL] test for E. coli) is included in each panel, reducing the need for additional or repeat testing. Interpretation of results is augmented by a rules-based data management expert system.

Alternative Approaches for Enhancing Resistance Detection Although the various conventional and commercial antimicrobial susceptibility test methods provide accurate results in most cases, certain clinically relevant resistance mechanisms can be difficult to detect. In these instances supplemental tests and alternative approaches are needed to ensure reliable detection of resistance. Also, as new and clinically important resistance mechanisms emerge and are recognized, a “lag time” will occur, during which conventional and commercial methods are being developed to ensure accurate detection of new resistance patterns. During such lag periods, special tests may be used until more conventional or commercial methods become available. Key examples of such alternative approaches are discussed in this section. Supplemental Testing Methods

Table 11-4 highlights some of the features of supplemental tests that may be used to enhance resistance detection.

For certain strains of staphylococci, conventional and commercial systems may have difficulty detecting resistance to oxacillin and related drugs methicillin and nafcillin. The oxacillin agar screen provides a backup test that may be used when other methods provide equivocal or uncertain profiles. Growth on the screen correlates with the presence of oxacillin (or methicillin) resistance, and no growth is strong evidence that an isolate is susceptible. This is important, because strains that are classified as resistant are considered resistant to all other currently available beta-lactam antibiotics, indicating the need for therapy to include the use of vancomycin. The agar screen plates can be made in-house but are also available commercially (e.g., Remel, Lenexa, KS; BBL, Cockeysville, MD). In addition, other commercial tests designed to detect oxacillin resistance more rapidly (i.e., 4 hours) have been developed and may provide another approach to supplemental testing (e.g., Crystal MRSA ID System, BBL, Sparks, MD). Rapid latex agglutination and immunochromatographic qualitative assays for the detection of penicillin-binding protein 2a (PBP2a) direct from S. aureus culture isolates as an aid in detecting methicillin-resistant Staphylococcus aureus (MRSA) are commercially available. Since 2012, the use of 30-mg cefoxitin disks has been recommended for disk diffusion to improve the detection of mecA-mediated oxacillin-resistant staphylococci (CLSI M100-S22). According to this method, cefoxitin inhibitory zones less than or equal to 21 mm for Staphylococcus aureus and Staphylococcus lugdunensis and less than or equal to 24 mm for coagulase-negative staphylococci (CoNS) indicate oxacillin resistance. Detection of mecA-mediated oxacillin-resistant Staphylococcus aureus and Staphylococcus lugdunensis can be performed by the broth dilution method. Growth in the presence of 4 mg/mL cefoxitin would indicate oxacillin resistance in these to two staphylococci species. Similarly, reduced staphylococcal susceptibility to vancomycin (i.e., MICs from 4-16 mg/mL) can be difficult to detect by disk diffusion and some commercial methods. Although the therapeutic relevance of staphylococci with

192 PA RT I I  General Principles in Clinical Microbiology

TABLE Supplemental Methods for Detection of Antimicrobial Resistance 11-4

Test

Purpose (Bacteria/ Antimicrobial-R)

Conditions

Interpretation

Oxacillin agar screen

Staphylococcus aureus/Penicillinase-resistant penicillins (e.g., oxacillin, methicillin, or nafcillin)

Medium: Mueller-Hinton agar plus 6 mg oxacillin/mL plus 4% NaCl Inoculum: 1 mL or swab from 1.5 3 108 standard suspension Incubation: 30°C-35°C 24 hr

Growth 5 resistance No growth 5 susceptible Read using transmitted light.

Cefoxitin to detect mecAmediated oxacillin resistance

Staphylococci (S. aureus and S. lugdunensis) and coagulase-negative staphylococci (CoNS)/oxacillin-resistance

Disk diffusion: MHA and 30 mg cefoxitin disk Incubation: 33°C-35°C, 16-18 hrs: S. aureus and S. lugdunensis; 24 hr: CoNS

16-18 hrs: S. aureus and S, lugdunensis, #21 mm 5 mecA positive; 22 mm 5 mecA negative 24 hr: CoNS, #24 mm 5 mecA positive; 25 mm 5 mecA negative

Vancomycin agar screen

Enterococci and staphylococci/vancomycinresistance

Medium: brain-heart infusion agar plus 6 mg vancomycin/mL Inoculum: Spot of 105-106 CFU Incubation: 35°C, 24 hr

Growth 5 Resistance No growth 5 Susceptible Read using transmitted light for staphylococci.

Aminoglycoside screens (high-level aminoglycoside resistance)

Enterococci/high-level resistance to aminoglycosides that would compromise synergy with a cell wall– active agent (e.g., ampicillin or vancomycin)

Medium: brain-heart infusion broth: 500 mg/mL gentamicin; 1000 mg/mL streptomycin Agar: 500 mg/mL gentamicin; 2000 mg/mL streptomycin Inoculum: Broth: 5 3 105 CFU/mL Agar: 106 CFU/spot Incubation: 35°C, 24 hr

Growth 5 Resistance No growth 5 Susceptible. For streptomycin only, if no growth at 24 hr, incubate additional 24 hr.

Oxacillin disk screen

Streptococcus pneumoniae/penicillin resistance

Medium: Mueller-Hinton agar plus 5% sheep blood plus 1 mg oxacillin disk Inoculum: swab with 1.5 x 108 CFU/mL suspension Incubation: 5%-7% CO2, 35°C; 20-24 hr

Inhibition zone 20 mm: penicillin susceptible Inhibition zone #19 mm: penicillin resistant, intermediate, or susceptible; further testing by MIC method required.

D-zone test

S. aureus, S. lugdunensis, CoNS, Streptococcus pneumoniae, and betahemolytic streptococci (e.g., group B)/inducible clindamycin resistance Differentiation of inducible iMLSB resistance (by ermA or ermC genes) versus erythromycin resistance by efflux mechanism (i.e., msrA gene)

Medium: 5% sheep blood agar or MHA (for staphylococci) or MHA plus 5% sheep blood (for streptococci) Antimicrobials: 15 mg erythromycin (E) and 2 mg clindamycin (Cd) (for staphylococci, space 15-26 mm apart; for streptococci, space 12 mm apart) Incubation: staphylococci: 35°C, air, 16-18 hr; streptococci: 35°C, 5% CO2, 20-24 hr

Flattening of Cd zone adjacent to E zone to give “D” pattern: inducible clindamycin resistance (i.e., iMLSB resistance) Report as clindamycin-R.

Carba NP confirmatory test

Enterobacteriaceae, Pseudomonas aeruginosa, Acinetobacter spp./ carbapenem resistance Performs well in detecting KPC, NDH, VIM, IMP, SPM, and SME carbapenemases; ability to detect other carbapenemases may vary.

Colorimetric microtube assay: tube A, solution A without imipenem; tube B, solution B with imipenem Phenol red indicator Inoculum: isolate plus bacterial protein extraction reagent Incubation: 35°C for up to 2 hrs

Tube A: red or red-orange or tube B: yellow 5 positive: carbapenemase present. Tube B: red or red-orange 5 negative: no carba­ penemase present.

CFU, Colony-forming units; MIC, minimum inhibitory concentration; MLSB, macrolide-lincosamide-streptogramin-B.

CHAPTER 11  Laboratory Methods and Strategies for Antimicrobial Susceptibility Testing

vancomycin MICs in this range is currently uncertain, the diminished susceptibility is outside the normal MIC range for susceptible strains; therefore this phenotype needs to be detected. The agar screen is essentially the same as for enterococci and is outlined in Table 11-4. Strains that grow on the screen should be tested by broth microdilution to obtain a definitive MIC value. Similarly, detection of enterococcal resistance to vancomycin can be difficult by some conventional and commercial methods, and the agar screen may be helpful in confirming the resistance pattern (Table 11-4). However, some enterococci that grow on the screening agar are not resistant to vancomycin at clinically relevant levels. Therefore MIC testing by the broth microdilution method should be performed. Resistant isolates that are nonmotile and nonpigmented can be assumed to have acquired resistance by transfer van A or van B genes, whereas motile, pigmented species such as Enterococcus gallinarium and Enterococcus casseliflavus express the van C gene responsible for their intrinsic resistance to vancomycin. Aminoglycosides also play a key role in therapy for serious enterococcal infections, and acquired high-level resistance, which essentially destroys the therapeutic value of these drugs for combination therapy with ampicillin or vancomycin, is not readily detected by conventional methods. Therefore screens using high concentrations of aminoglycosides (Table 11-4) have been developed and are available commercially (e.g., Remel, Lenexa, KS; BBL, Cockeysville, MD). With emergence of penicillin resistance in S. pneumoniae, the penicillin disk diffusion test became insufficiently sensitive to detect subtle but significant changes in susceptibility to penicillin. To address this issue, the oxacillin disk screen described in Table 11-4 is useful with a notable limitation. Organisms identified with zones greater than or equal to 20 mm can be accurately characterized as penicillin susceptible; however, the penicillin susceptibility status of isolates with zones less than 20 mm remains uncertain, and subsequent testing using a MIC test method must be done to determine whether the isolate is susceptible or resistant to penicillin. With regard to macrolide (e.g., erythromycin, azithromycin, clarithromycin) and lincosamide (e.g., clindamycin) resistance among staphylococci, interpretation of in vitro results can be complicated by different underlying mechanisms of resistance with very different therapeutic implications. Isolates that produce a profile of resistance to a macrolide (e.g., erythromycin) and susceptibility to clindamycin may result from two different resistance mechanisms. If this profile is the result of the efflux (msrA gene) mechanism, the isolate can be considered susceptible to clindamycin. However, if this profile occurs through the inducible macrolide-lincosamide-streptogramin-B (iMLSB) mechanism, encoded by an erythromycin ribosomal methylase gene that alters the ribosomal target, this can cause bacteria to rapidly become clindamycin-resistant during therapy with this agent. Currently such strains should be reported as resistant to clindamycin. The D test that is used to distinguish between these two different resistance mechanisms is described in Table 11-4.

193

Multidrug-resistant organisms continue to emerge; of particular concern are gram-negative rods that are resistant to extended beta-lactam antibiotics and carbapenems. Screening and confirmatory tests for these resistant phenotypes are described in Tables 3A, 3B, and 3C in M100-S25. In 2010 interpretive criteria for cefazolin, cefotaxime, ceftazidime, ceftizoxime, ceftriaxone, and aztreonam were revised. Using these new interpretive criteria, routine testing for extended-spectrum beta-lactamases (ESBL) is no longer necessary. However, ESBL testing may be performed for epidemiologic or infection control purposes (see CLSI Document M100-S25). Likewise, additional testing for carbapenemase production may be warranted in species belonging to the Family Enterobacteriaceae, Pseudomonas aeruginosa, and Acinetobacter spp. Ninety percent sensitivity and specificity of the carba NP test in detecting Klebsiella pneumoniae carbapenemase (KPC), New Delhi metallo-beta-lactamase (NDM-1), Verona integron-encoded metallo-beta-lactamase (VIM), metallo-beta-lactamases (IMP & SPM), and SME-Class A type carbapenemase has been reported, but detection of other carbapenemases vary. Molecular assays to look for specific carbapenemase genes can also be performed but are not needed for clinical decisions. Routine detection of carbapenem resistance can be accomplished by using revised interpretive guidelines published first in June 2010 in M100S20-U. MIC interpretive criteria for resistance to imipenem and meropenem is equal to or greater than 4 mg/mL and for ertapenem is equal to or greater than 2 mg/mL. Undoubtedly, as complicated resistance mechanisms requiring laboratory detection continue to emerge, screening and supplemental testing methods will continue to be developed. Some of these will be maintained as the primary method for detecting a particular resistance mechanism, whereas others may tend to fade away as adjustments in conventional and commercial procedures enhance resistance detection and preclude the need for a supplemental test. Predictor Antimicrobial Agents

Another approach that may be used to ensure accuracy in resistance detection is the use of “predictor” antimicrobial agents in the test batteries. The basic premise of this approach is to use antimicrobial agents (predictor drugs) that are the most sensitive indicators of certain resistance mechanisms. The profile obtained with such a battery is used to deduce the underlying resistance mechanism. A susceptibility report then is produced based on the likely effect the resistance mechanisms would have on the antimicrobials being considered for therapeutic use. The use of predictor drugs is not a new concept, and this approach has been taken in a number of cases, such as the following: • Staphylococcal resistance to oxacillin is used to determine and report resistance to all currently available beta-lactams, including penicillins, cephalosporins, and carbapenems.

194 PA RT I I   General Principles in Clinical Microbiology

• Enterococcal high-level gentamicin resistance predicts resistance to nearly all other currently available aminoglycosides, including amikacin, tobramycin, netilmicin, and kanamycin. • Enterococcal resistance to ampicillin predicts resistance to all penicillin derivatives.

Methods that Directly Detect Specific Resistance Mechanisms As an alternative to detecting resistance by measuring the effect of antimicrobial presence on bacterial growth, some strategies focus on assaying for the presence of a particular mechanism. When the presence or absence of the mechanism is established, the resistance profile of the organism can be generated without having to test several different antimicrobial agents. The utility of this approach, which can involve phenotypic and genotypic methods, depends on the presence of a particular resistance mechanism as being a sensitive and specific indicator of clinical resistance.

Phenotypic Methods The most common phenotypic-based assays test for the presence of beta-lactamase enzymes in the clinical bacterial isolate of interest. Less commonly used tests detect the chloramphenicol-modifying enzyme chloramphenicol acetyltransferase. Beta-Lactamase Detection

Beta-lactamases play a key role in bacterial resistance to beta-lactam agents, and detection of their presence can provide useful information (Chapter 10). Various assays are available to detect beta-lactamases, but the most useful in clinical laboratories is the chromogenic cephalosporinase test. Beta-lactamases exert their effect by opening the beta-lactam ring (Figure 11-9). When a chromogenic cephalosporin (e.g., nitrocefin) is used as the substrate, this process results in a colored product. The Cefinase disk (BD Microbiology Systems, Cockeysville, MD) is an example of a commercially available chromogenic test (Figure 11-14). A positive test indicates resistance to penicillin, ampicillin, amoxicillin, carbenicillin, mezlocillin, and piperacillin. A

B

• Figure 11-14  The chromogenic cephalosporin test allows direct detection of beta-lactamase production. When the beta-lactam ring of the cephalosporin substrate in the disk is hydrolyzed by the bacterial inoculum, a deep pink color is produced (A). Lack of color production indicates the absence of beta-lactamase (B).

Useful application of tests to directly detect beta-lactamase production is limited to organisms producing enzymes whose spectrum of activity is known. This also must include the beta-lactams commonly considered for therapeutic eradication of the organism. Examples of useful applications include detection of: • Enterococcus resistance to ampicillin • N. gonorrhoeae resistance to penicillin • H. influenzae resistance to ampicillin • Bacteroides spp. and other gram negative anaerobes resistance to penicillin and ampicillin • Staphylococci resistance to penicillin, if negative do zone edge test (disk diffusion with penicillin) to detect penicillin resistance caused by other mechanisms The actual utility of this approach, even for the organisms listed, is decreasing. As beta-lactamase–mediated resistance has become widespread among N. gonorrhoeae, H. influenzae, and staphylococci, other agents not affected by the betalactamases have become the therapeutic antimicrobials of choice. Therefore the need to know the beta-lactamase status of these bacterial species has become less urgent. Whereas several Enterobacteriaceae and P. aeruginosa produce betalactamases, the effect of these enzymes on the various beta-lactams depends on which enzymes are produced. Therefore a positive beta-lactamase assay provides little or no information about which antimicrobial agents are affected. Thus it is recommended that detection of beta-lactam resistance among these organisms be accomplished using conventional and commercial systems that directly evaluate antimicrobial agent/organism interactions. Chloramphenicol Acetyltransferase Detection

Chloramphenicol modification by chloramphenicol acetyltransferase (CAT) is one mechanism by which bacteria may express resistance to this agent. This, coupled with diminished use of chloramphenicol in today’s clinical settings, significantly limits the use of the CAT detection test. Commercial assays provide a convenient method to detect this enzyme. If the CAT is positive, chloramphenicol resistance can be reported, but a negative test result does not rule out resistance mediated by other mechanisms, such as decreased uptake of the drug.

Genotypic Methods The genes that encode many of the clinically relevant acquired resistance mechanisms are known, as are all or part of their nucleotide sequences. This has allowed for the development of molecular methods involving nucleic acid hybridization and amplification for the study and detection of antimicrobial resistance (for more information on molecular methods for the characterization of bacteria, see Chapter 8). The ability to definitively determine the pre­ sence of a particular gene encoding antimicrobial resistance has several advantages, but limitations also exist. From a research and development perspective, molecular methods can more thoroughly characterize resistance profiles of bacterial collections used to establish and evaluate

CHAPTER 11  Laboratory Methods and Strategies for Antimicrobial Susceptibility Testing

conventional standards recommended by CLSI. Phenotypebased commercial susceptibility testing methods and systems, both automated and nonautomated, can also be evaluated. For example, matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF MS) mass spectrometry can be used to detect antimicrobial resistance by beta-lactamase, and carbapenemases can be detected by mixing the bacterial isolate with the beta-lactam or carbapenem substrates and then assaying the supernatant looking for a shift in the peptide mass fingerprint (PMF) from nonhydrolyzed to hydrolyzed products. Molecular methods may be directly applied in the clinical setting as an adjunct to investigate and arbitrate equivocal results obtained by phenotypic methods. For example, the clinical importance of accurately detecting methicillin resistance among staphylococci, coupled with the inconsistencies of phenotypic methods, is problematic. In doubtful situations, molecular detection of the mecA gene encoding methicillin resistance can be applied to definitively establish an isolate’s methicillin resistance. Similarly, doubt raised by equivocal phenotypic results obtained with potentially vancomycin-resistant enterococci can be resolved by establishing the presence and classification of the van genes that mediate this resistance. Although molecular methods have been and will continue to be extremely important in antimicrobial resistance detection, numerous factors still complicate their use beyond supplementing phenotype-based susceptibility testing protocols. These factors include the following: • Use of probes or oligonucleotides for specific resistance genes. Resistance mediated by divergent genes or totally different mechanisms could be missed (i.e., the absence of one gene may not guarantee antimicrobial susceptibility). • Phenotypic resistance to a level that is clinically significant for any one antimicrobial agent may be the result of a culmination of processes that involve enzymatic modification of the antimicrobial, decreased uptake, altered affinity of the drug’s target, or some combination of mechanisms (i.e., the presence of one gene does not guarantee resistance). • The presence of a gene encoding resistance does not provide information about the status of the control genes necessary for expression of resistance; that is, although present, the genes may be silent or nonfunctional, and the organism may not be capable of expressing the resistance encoded by the gene. • From a clinical laboratory perspective, it may be impractical to adopt molecular methods specific for only a few resistance mechanisms when most susceptibility testing still will be accomplished using phenotypic-based methods. Items to consider before adopting molecular tests may include (but are not limited to) clinical efficacy, space, personnel, and financial management. Even though adoption of molecular methods for routine antimicrobial susceptibility testing poses challenges, these methods will continue to enhance detection of antibiotic resistance.

195

Special Methods for Complex Antimicrobial/ Organism Interactions Certain in vitro tests have been developed to investigate aspects of antimicrobial activity not routinely addressed by commonly used susceptibility testing procedures. Specifically, these are tests designed to measure bactericidal activity (i.e., bacterial killing) or to measure the antibacterial effect of combination therapy with antimicrobial agents. These tests are often labor intensive, fraught with technical problems, commonly difficult to interpret, and of uncertain clinical utility. For these reasons, their use should be limited and they should be done only if expert microbiology and infectious disease consultants are available.

Bactericidal Tests Bactericidal tests are designed to determine the ability of antimicrobial agents to kill bacteria. The killing ability of most drugs is already known, and antimicrobials are commonly classified as bacteriostatic or bactericidal agents. However, many variables, including the concentration of antimicrobial agent and the species of targeted organism, can influence this classification. For example, beta-lactams, such as penicillin, typically are bactericidal against most gram-positive cocci but are usually only bacteriostatic against enterococci. If bactericidal tests are clinically appropriate, they should be applied only to evaluate antimicrobials typically considered to be bactericidal (e.g., beta-lactams and vancomycin) and not to agents known to be bacteriostatic (e.g., macrolides). Situations in which achieving bactericidal activity is of greatest clinical importance include severe and life-threatening infections, infections in immunocompromised patients, and infections in body sites where assistance from the patient’s own defenses is minimal (e.g., endocarditis or osteomyelitis). Based on research using animal models and clinical trials in humans, the most effective therapy for these types of infections is often already known. However, occasionally the laboratory may be asked to substantiate that bactericidal activity is being achieved or is achievable. The methods available for this include minimal bactericidal concentration (MBC) testing, time-kill studies, and serum-bactericidal testing (SBT). Regardless of the method used, the need to interpret the results cautiously, with the understanding of uncertain clinical correlation and the potential for substantial technical artifacts, cannot be overemphasized. Minimal Bactericidal Concentration

The MBC test involves continuation of conventional broth dilution testing. After incubation and determination of the antimicrobial agent’s MIC, an aliquot from each tube or well in the dilution series demonstrating inhibition of visible bacterial growth is subcultured to an enriched agar medium (e.g., sheep blood agar). After overnight incubation, the plates are examined and the CFUs determined. With the volume of the aliquot and the number of CFUs

196 PA RT I I  General Principles in Clinical Microbiology

obtained, the number of viable cells per milliliter for each antimicrobial dilution can be calculated. This number is compared with the known CFU per milliliter in the original inoculum. The antimicrobial concentration resulting in a 99.9% reduction in CFU per milliliter compared with the organism concentration in the original inoculum is recorded as the MBC. Although the clinical significance of MBC results is uncertain, this information may be helpful in determining whether treatment failure could be a result of the organism’s MBC exceeding the serum-achievable level for the antimicrobial agent. Alternatively, if an antibiotic’s MBC is greater than or equal to 32 times higher than its MIC, the organism may be tolerant to the drug. Tolerance is a phenomenon most commonly associated with bacterial resistance to beta-lactam antibiotics that reflects an organism’s ability to be inhibited, not killed, by an agent that is usually bactericidal. Although the physiologic basis of tolerance has been studied in several bacterial species, the actual clinical relevance of this phenomenon has not been established. Time-Kill Studies

Another approach to examining bactericidal activity of an antimicrobial agent involves exposing a bacterial isolate to a concentration of antibiotic in a broth medium and measuring the rate of killing over a specified time period. In time-kill studies, samples are taken from the antibioticbroth solution immediately after addition of the inoculum and at regular intervals afterward. Each time-sample is plated to agar plates; after incubation, CFU counts are performed as described for MBC testing. The number of viable bacteria from each sample is plotted over time to determine the rate of killing. Generally, a 1000-fold decrease in the number of viable bacteria in the antibiotic-containing broth after a 24-hour period, compared with the number of bacteria in the original inoculum, is interpreted as bactericidal activity. Although time-kill analysis is frequently used in the research environment to study the in vitro activity of antimicrobial agents, the labor intensity and technical specifications of the procedure preclude its use in most clinical microbiology laboratories to predict and monitor treatment of a patient’s infection. Serum Bactericidal Test (Schlichter Test)

The serum bactericidal test (SBT), also known as the Schlichter test, is analogous to the MIC-MBC test except that the test medium used is the patient’s serum containing the therapeutic antimicrobial agents the patient has been receiving. Using the patient’s serum to detect bacteriostatic and bactericidal activity allows observation of the antibacterial effect of factors other than the antibiotics (e.g., antibodies and complement). Two serum samples are required for each test. One is collected just before (within 30 minutes) the patient is to receive the next antimicrobial dose (i.e., trough specimen). The other sample is collected after the antimicrobial agent(s) is given when the serum antimicrobial

concentration is highest (i.e., peak specimen). The appropriate time to collect the peak specimen varies with pharmacokinetic properties of the antimicrobial agents and their route of administration. Peak levels for intravenously, intramuscularly, and orally administered agents are generally obtained 30 to 60 minutes, 60 minutes, and 90 minutes after administration, respectively. The trough and peak samples should be collected for the same dose and tested simultaneously. Serial twofold dilutions of trough and peak serum samples are prepared and inoculated with the bacterial isolate from the patient (final inoculum of 5 3 105 CFU/mL). Dilutions are incubated overnight. The highest dilution that inhibits visibly detectable growth is the serum-static titer (e.g., 1:8, 1:16, 1:32). Aliquots of known size are then taken from each dilution at or below the serum-static titer (i.e., dilutions that inhibited bacterial growth) and are plated on sheep blood agar plates. After incubation, the CFUs per plate are counted, and the serum dilution resulting in a 99.9% reduction in the CFU/mL, compared with the original inoculum, is recorded as the serum-cidal titer. For example, if a bacterial isolate showed a serum-static titer of 1:32, the tubes containing dilutions of 1:2, 1:4, 1:8, 1:16, and 1:32 would be subcultured. If the 1:8 dilution was the highest dilution to yield a 99.9% decrease in CFUs, the serum-cidal titer would be recorded as 1:8. The SBT was originally developed to aid in predicting the clinical efficacy of antimicrobial therapy for staphylococcal endocarditis. Peak serum-cidal titers of 1:32 to 1:64 or greater have been thought to correlate with a positive clinical outcome. However, even though the test is performed on the patient’s serum, many differences go unaccounted for between the in vitro test environment and the in vivo site of infection. Therefore although the test is used to evaluate whether effective bactericidal concentrations are being achieved, the predictive clinical value for staphylococcal endocarditis or other infections caused by other bacteria remains uncertain. Details regarding the performance of these bactericidal tests are provided in the CLSI document M26-A, “Methods for Determining Bactericidal Activity of Antimicrobial Agents.”

Tests for Activity of Antimicrobial Combinations Therapeutic management of bacterial infections often requires simultaneous use of more than one antimicrobial agent. Some of the reasons for use of multiple therapies include: • Treating polymicrobial infections caused by organisms with different antimicrobial resistance profiles • Achieving more rapid bactericidal activity than may be achieved with any single agent • Achieving bactericidal activity against bacteria for which no single agent is lethal • Minimizing the emergence of resistant organisms during therapy Testing the effectiveness of antimicrobial combinations against a single bacterial isolate is referred to as synergy testing.

CHAPTER 11  Laboratory Methods and Strategies for Antimicrobial Susceptibility Testing

When combinations are tested, three outcome categories are possible: • Synergy: the activity of the antimicrobial combination is substantially greater than the activity of the single most active drug alone • Indifference: the activity of the combination is no better or worse than the single most active drug alone • Antagonism: the activity of the combination is substantially less than the activity of the single most active drug alone (an interaction to be avoided) The checkerboard assay and the time-kill assay are two basic methods of synergy testing but are not routinely performed in the clinical laboratory. In the checkerboard method, MIC panels are set up containing two antimicrobial agents serially diluted independently and in combination. After inoculation and incubation, the MICs obtained with the individual agents and the various combinations are recorded. By calculating the MIC ratios obtained with individual and combined agents, the drug combination in question is classified as synergistic, indifferent, or antagonistic. With the time-kill assay, the same procedure described for testing bactericidal activity is used, except that the killing curve obtained with a single agent is compared with the killing curve obtained with antimicrobial combinations. Synergy is indicated when the combination exhibits killing that is greater by 100-fold or more than the most active single agent tested alone after 24 hours of incubation. Killing rates between the most active agent and the combination that are similar are interpreted as indifference. Antagonism is evident when the combination appears less active than the most active single agent. The decision to use more than one antimicrobial agent may be based on antimicrobial resistance profiles or identification of particular bacterial pathogens reported by the clinical microbiology laboratory. However, the decision regarding which antimicrobial agents to combine should

not rely on the results of complex synergy tests. Most clinically useful antimicrobial combinations have been investigated in a clinical research setting and are well described in the medical literature. These data should be used to guide the decision for combination therapy. The technical difficulties associated with performing and interpreting synergy tests preclude their utility in the diagnostic setting.

Laboratory Strategies for Antimicrobial Susceptibility Testing The clinical microbiology laboratory is responsible for maximizing the positive impact that susceptibility testing information can have on the use of antimicrobial agents to treat infectious diseases. However, meeting this responsibility is difficult because of demands for more efficient use of laboratory resources, increasing complexities of important bacterial resistance profiles, and continued expectations for high-quality results. To ensure quality in the midst of dwindling resources and expanding antimicrobial resistance, strategies for antimicrobial susceptibility testing must be carefully developed. These strategies should target relevance, accuracy, and communication (Figure 11-15).

Relevance Antimicrobial susceptibility testing should be performed only when sufficient potential exists for providing clinically useful and reliable information about antimicrobial agents appropriate for the bacterial isolate in question. Therefore for the sake of relevance, two questions must be addressed: • When should testing be performed? • Which antimicrobial agents should be tested?

Relevance • • • •

Clinical significance of bacterial isolate Predictability of isolate’s susceptibility Availability of standardized test methods Selection of appropriate antimicrobial agents Accuracy

Effective antimicrobial susceptibility testing

197

• Use of reliable methods • Prompt and thorough review of results • Prompt resolution of unusual results Communication • Augment susceptibility reports with messages that help clarify and explain potential therapeutic problems not necessarily evident by data alone

• Figure 11-15  Goals of effective antimicrobial susceptibility testing strategies.

198 PA RT I I   General Principles in Clinical Microbiology

When to Perform a Susceptibility Test The first issue that must be resolved is whether antimicrobial susceptibility testing is appropriate for a particular isolate. Although the answer may not always be clear, the issue must always be addressed. The decision to perform susceptibility testing depends on the following criteria: • Clinical significance of a bacterial isolate • Predictability of a bacterial isolate’s susceptibility to the antimicrobial agents most commonly used against them, often referred to as the therapeutic drugs of choice • Availability of reliable standardized methods for testing the isolate

Determining Clinical Significance Performing tests and reporting antimicrobial susceptibility data on clinically insignificant bacterial isolates are a waste of resources and, more importantly, can mislead physicians, who depend on laboratory information to assist in establishing the clinical significance of a bacterial isolate. Useful criteria for establishing the clinical importance of a bacterial isolate include: • Detection and/or the abundance of the organism on direct Gram stain of a patient’s specimen, preferably in the presence of white blood cells, and growth of an organism with the same morphology in culture • Known ability of the bacterial species isolated to cause infection at the body site from which the specimen was obtained (see Part VII) • Whether the organism is usually considered either an epithelial or mucosal colonizer or is usually considered a pathogen • Body site from which the organism was isolated (normally sterile or typically colonized) Although these criteria are helpful and heavily depend on the capacity of the bacterial species isolated to cause disease, the final designation of clinical significance often still requires dialog between laboratory professionals and the physicians responsible for the patient’s care. Reporting susceptibility results for organisms with questionable clinical importance may be incorrectly interpreted as an indicator of clinical significance. Therefore using criteria such as those listed should be included in the laboratory’s antimicrobial susceptibility testing strategy.

Predictability of Antimicrobial Susceptibility If the organisms are clinically significant, then the chances that they could be resistant to the antimicrobial agents commonly used to eradicate them must be determined. Unfortunately, the increasing dissemination of resistance among clinically relevant bacteria has diminished the number of bacteria for which antimicrobial susceptibility can be confidently predicted based on identification without the need to perform testing. Table 11-5 categorizes many of the commonly encountered bacteria according to the need to perform testing to detect resistance.

TABLE Categorization of Bacteria According to Need for Routine Performance of Antimicrobial 11-5

Susceptibility Testing*

Need for Testing

Bacteria

Testing commonly required

Staphylococci Streptococcus pneumoniae Viridans streptococci† Enterococci Enterobacteriaceae Pseudomonas aeruginosa Acinetobacter spp.

Testing occasionally required‡

Haemophilus influenzae Neisseria gonorrhoeae Moraxella catarrhalis Anaerobic bacteria

Testing rarely required

Beta-hemolytic streptococci (groups A, B, C, F, and G) Neisseria meningitidis Listeria monocytogenes

*Based on the assumption that the organism is clinically significant. Table includes bacteria for which standardized testing procedures are available, as outlined and recommended by the Clinical and Laboratory Standards Institute (CLSI). † Viridans streptococci require testing when implicated in endocarditis or isolated in pure culture from a normally sterile site with a strong suspicion of being clinically important. ‡ Testing required if an antimicrobial to which the organisms are frequently resistant is still considered for use (e.g., penicillin for Neisseria gonorrhoeae).

Acquired resistance to various antimicrobial agents dictates susceptibility testing be performed on all clinically relevant isolates of several bacterial groups, genera, and species. For other organisms, such as H. influenzae and N. gonorrhoeae, resistance to the original drugs of choice (ampicillin, penicillin, and recently ceftriaxone) has become widespread, and more potent antibiotics (e.g., ceftriaxone), for which no resistance has been described, have become the drugs of choice. Therefore although testing used to be routinely indicated to detect ampicillin and penicillin resistance, testing for resistance to currently recommended antimicrobials for these organisms is not usually necessary. A possible exception to this is the relatively recent emergence of fluoroquinolone resistance in N. gonorrhoeae that may warrant testing of clinical isolates. One notable exception to the widespread emergence of resistance has been the absence of penicillin resistance among beta-hemolytic streptococci. Because susceptibility to penicillin is extremely predictable among these organisms, testing against penicillin provides little, if any, information not already provided by accurate organism identification. However, if the patient cannot tolerate penicillin, alternative agents, such as erythromycin, may be considered. Because erythromycin resistance among beta-hemolytic streptococci has been well documented, susceptibility testing in this instance is indicated. The recommendations outlined in Table 11-5 are guidelines. In any clinical setting, exceptions will arise that must

CHAPTER 11  Laboratory Methods and Strategies for Antimicrobial Susceptibility Testing

be considered in consultation with the physician. These guidelines are designed to provide data for the management of a single patient’s infection. However, these guidelines may not necessarily apply when susceptibility testing is performed to gather surveillance data to monitor emerging resistance (see Accuracy and Antimicrobial Resistance Surveillance later in this chapter).

Availability of Reliable Susceptibility Testing Methods If a reliable, standardized method for testing a particular bacterial genus or species does not exist, the ability to produce accurate and meaningful data is substantially compromised. Although standard methods exist for most of the commonly encountered bacteria (Tables 11-1 to 11-3), clinically relevant isolates of bacterial species for which standard testing methods do not exist are encountered. In these instances, the dilemma stems from the conflict between the laboratorian’s desire to contribute in some way by providing data and the lack of confidence in producing interpretable and accurate information. Many organisms not listed in Table 11-5 grow on the media and under the conditions recommended for testing commonly encountered bacteria. However, the ability to grow and the ability to detect important antimicrobial resistance patterns are not the same thing. For example, the gram-negative bacillus Stenotrophomonas maltophilia grows extremely well under most susceptibility testing conditions, but the results obtained with beta-lactam antibiotics can vary widely and be seriously misleading. This organism produces potent beta-lactamases that seriously compromise the effectiveness of most beta-lactam agents, yet certain isolates may appear susceptible by standard in vitro testing criteria. Therefore even though testing may provide a potential answer, the answer may be incorrect. Given the uncertainty surrounding the testing of bacteria for which standardized methods are lacking, two approaches may be used. One is to not perform testing, but rather to provide physicians with information based on clinical studies published in the medical literature about the antimicrobial agents generally accepted as the drugs of choice for the bacterial species in question. This approach is best handled when the laboratory medical director and infectious disease specialists are involved. The other option is to provide the information from the literature and also perform the test to the best of the laboratory’s ability. In this case results must be accompanied by a disclaimer indicating that testing was performed by a nonstandardized method and results should be interpreted with caution. When such tests are undertaken, customized antimicrobial batteries, including the agents most commonly used to eradicate the bacterial species of interest, need to be assembled and communicated to the physician. Recently CLSI has published the document M45 to provide guidelines for the testing of certain less frequently encountered bacteria.

199

Selection of Antimicrobial Agents for Testing Selection of relevant antimicrobial agents is based on the criteria outlined in Box 11-1. These criteria should be carefully considered when antimicrobial agents are selected to avoid cluttering reports with superfluous information, to minimize the risk of confusing physicians, and to substantially decrease the waste of time and resources in the clinical microbiology laboratory. Antimicrobial agents that may be considered for inclusion in batteries to be tested against certain bacterial groups are provided in Table 11-6. The list is not exhaustive but is useful for illustrating some points about developing relevant antimicrobial test batteries. For example, with all the penicillins, cephalosporins, and other betalactam antibiotics available for testing, only penicillin and cefoxitin (or oxacillin) need to be tested against staphylococci. The information acquired with these two agents reflects the general effectiveness of any other beta-lactam. In essence, these drugs are predictor agents, as discussed earlier in this chapter. Similarly, ampicillin can be used independently as an indicator of enterococcal susceptibility to various penicillins, and because of intrinsic resistance, cephalosporins should never be tested against these organisms. In contrast to the relatively few agents that may be included in testing batteries for gram-positive cocci, several potential choices exist for use against gram-negative bacilli. This is mostly because of the commercial availability of several beta-lactams with similar activities against Enterobacteriaceae and the general inability of one betalactam to serve as a reliable predictor drug for other betalactams. Although cefazolin is recommended as a predictor drug for oral cephalosporins for urinary tract isolates, an organism resistant to cefazolin may or may not be resistant to cefotetan, and an organism resistant to cefotetan may or may not be resistant to ceftazidime. Thus because of the lack of potential for selecting a predictor drug in these instances, more agents must be tested. However, in some instances overlap in activities does exist, so some duplication of effort can be avoided. For example, the spectra of activity of ceftriaxone and cefotaxime are sufficiently similar to allow the use of one in the testing battery. Many scenarios exist in which the spectrum of activity and other criteria listed in Box 11-1 are considered for the sake of designing the most relevant and useful testing batteries. These criteria should be considered in consultation with patients’ physicians and the pharmacy staff.

Accuracy Susceptibility testing strategies focused on production of accurate results have two key components: • Use of methods that produce accurate results • The application of real-time review of results before reporting

200 PA RT I I   General Principles in Clinical Microbiology

TABLE Selection of Antimicrobial Agents for Testing Against Common Bacterial Groups* 11-6

Antimicrobial Agents

Enterobacteriaceae

Pseudomonas aeruginosa

Staphylococci

Enterococci

Streptococcus pneumoniae

Viridans Streptococci

Penicillin

2

2

1

2

1

1

Cefoxitin for oxacillin susceptibility

2

2

1

2

2

2

Ampicillin

1

2

2

1

2

2

Piperacillin/ tazobactam

1

1

2

2

2

2

Cefazolin

1

2

2

2

2

2

Cefotetan

1

2

2

2

2

2

Ceftriaxone

1

2

2

2

1

1

Ceftazidime

1

1

2

2

2

2

Ceftaroline

1

2

2

1

2

Aztreonam

1

1

2

2

2

2

Imipenem

1

1

2

2

6

2

2

2

1

1

1

1

Gentamicin

1

1

6

1†

2

2

Tobramycin

1

1

2

2

2

2

Amikacin

1

1

2

2

2

2

Ciprofloxacin

1

1

1

2

1

2

Levofloxacin

1

1

1

2

1

1

Erythromycin

2

2

1

2

1

1

Clindamycin

2

2

1

2

1

1

Trimethoprimsulfamethoxazole

1

2

1

2

1

2, 6

Tigecycline

1

2

1

1

6

1

Daptomycin

2

2

1

1

6

6

Linezolid

2

2

1

1

6

1

Penicillins

Cephalosporins

1 (S. aureus only)

Other Beta-Lactams

Glycopeptides Vancomycin

Aminoglycosides

Quinolones

Other Agents

1, May be selected for inclusion in testing batteries (not all agents with 1 need to be selected); 6, may be selected in certain situations; 2, selection for testing is not necessary or not recommended. *Not all available antimicrobial agents are included. Selection recommendation is based on non–urinary tract infections. † Gentamicin testing against enterococci requires use of high-concentration disks or a special screen (see Table 11-4). ‡Daptomycin should not be reported for isolates from the respiratory tract.

CHAPTER 11  Laboratory Methods and Strategies for Antimicrobial Susceptibility Testing

Use of Accurate Methodologies Because of the complexities of the various resistance mechanisms, no one method, conventional, automated, or molecular, is sufficient for detection of all clinically relevant resistance patterns. Therefore the selection of testing methods and careful consideration of how different methods are most effectively used together is necessary to ensure accurate and reliable detection of resistance. Microbiologists must be aware of the strengths and weaknesses of the primary susceptibility testing methods in the laboratory for detecting relevant resistance patterns and know when adjunct or supplemental testing is necessary. This awareness is accomplished by reviewing studies published in peer-reviewed journals focusing on the performance of antimicrobial testing systems and periodically challenging one’s own system with organisms that have been thoroughly characterized with respect to their resistance profiles (e.g., proficiency testing programs). Furthermore, accurate and relevant testing not only means using various conventional methods or even using a mixture of automated, conventional, and screening methods, but also encompasses the potential application of molecular techniques and predictor drugs. Testing of S. pneumoniae provides one example of the need to be aware of testing limitations and the importance of implementing supplemental tests. Not long ago, routine susceptibility testing of S. pneumoniae was considered unnecessary. However, with the emergence of beta-lactam resistance, testing has become imperative. As the need for testing emerged, the inability of conventional tests, such as penicillin disk diffusion, to detect resistance became apparent. Fortunately, a test that uses the penicillin derivative oxacillin was developed and is widely used as a reliable screen for detecting resistance to penicillin. However, this test is only a screen, because the level of penicillin intermediate resistance (i.e., the MIC) can vary greatly among nonsusceptible isolates, and some strains that appear resistant by the screen may actually be susceptible. Because the level of resistance can affect therapeutic decisions, another method that allows for MIC determinations should be used to test these organisms. In addition, the emergence of cephalosporin (i.e., ceftriaxone or cefotaxime) resistance requires the use of tests for the detection of resistance to these agents. Other important examples in which more than one method is required to obtain complete and accurate susceptibility testing data for certain organism groups or species include vancomycin-resistant enterococci; methicillin-resistant staphylococci; and extended spectrum, beta-lactamase–producing Enterobacteriaceae. In addition, molecular methods also may be used in the clinical setting as an important backup resource to investigate and arbitrate equivocal results obtained by phenotypic methods. However, multiple testing protocols are not routinely necessary for every organism encountered in the clinical laboratory. In most laboratories, one conventional or

201

commercial method is likely to be the mainstay for testing, with additional testing available as a supplement when necessary.

Review of Results In addition to selecting one or more methods to accurately detect resistance, the strengths and weaknesses of the testing systems must be continuously monitored. This is primarily accomplished by carefully reviewing the susceptibility data produced daily. In the past, establishing and maintaining aggressive and effective monitoring programs have been prohibitively labor intensive. However, the speed and flexibility afforded by computerization of results review and reporting greatly facilitate the administration of such quality assurance programs, even in laboratories with modest resources. Effective computer programs may be a part of the general laboratory information system (or, in some cases, such programs are available through the commercial susceptibility testing system). Because automated expert data review greatly facilitates the review process and enhances data accuracy, this feature should be seriously considered when selecting an antimicrobial susceptibility testing system. Susceptibility profiles must be scrutinized manually or with the aid of computers according to what profiles are likely, somewhat likely, somewhat unlikely, and nearly impossible. This awareness not only pertains to profiles exhibited by organisms in a particular institution, but also to those exhibited by clinically relevant bacteria in general. The unusual resistance profiles must be discovered and evaluated expeditiously to determine whether they are the result of technical or clerical errors or are truly indicative of an emerging resistance problem. The urgency of making this determination is twofold. First, if the profile results from laboratory error, it must be corrected and the physician notified so the patient is not subjected to ineffective or inappropriate antimicrobial therapy. Second, if the profile is valid and presents a threat to the patient and to others (e.g., the emergence of vancomycin-resistant staphylococci), immediate notification of infection control and infectious disease personnel is warranted.

Components of Results Review Strategies Any laboratory strategy for monitoring the accuracy of results and the emergence of resistance must have two components: • Data review—a mechanism for recognizing new or unusual susceptibility profiles • Resolution—the application of protocols for determining whether an unusual profile is a result of an error (technical or clerical) or accurately reflects the emergence of a new resistance mechanism Both components must be integrated into the review process to ensure efficient and timely use of resources.

202 PA RT I I   General Principles in Clinical Microbiology

TABLE Examples of Susceptibility Testing Profiles Requiring Further Evaluation 11-7

Organism

Susceptibility Profile

All bacterial isolates

Nonsusceptible (NS) results

Staphylococci

Vancomycin intermediate or resistant Clindamycin resistant; erythromycin susceptible Linezolid resistant Daptomycin resistant

Beta-hemolytic streptococci

NS result for ampicillin or penicillin or any other appropriate antimicrobial tested

Streptococcus pneumoniae

NS results for vancomycin or linezolid; fluoroquinolone or meropenem intermediate or resistant

Viridans streptococci

NS results to any or all: vancomycin, daptomycin, ertapenem, linezolid; quinupristin-dalfopristin intermediate or resistant

Enterococci

Vancomycin resistant, high level of aminoglycoside resistance by disk diffusion

Enterococcus faecium

Linezolid resistant

Acinetobacter baumannii

Colistin/polymyxin B and/or carbapenem resistant

Enterobacteriaceae

Gentamicin, tobramycin, and amikacin resistant; any carbapenem intermediate or resistant

Enterobacter/Citrobacter/Serratia/ Morganella/Providencia/Klebsiella

Susceptible to ampicillin or cefazolin

Pseudomonas aeruginosa

Amikacin resistant; gentamicin or tobramycin susceptible; carbapenem resistant

Stenotrophomonas maltophilia

Imipenem susceptible; trimethoprim/sulfamethoxazole intermediate or resistant

Neisseria gonorrhoeae

Ceftriaxone resistant

Neisseria meningitidis

Ampicillin or penicillin resistant; NS result for meropenem

Modified from Courvalin P: Interpretive reading of antimicrobial susceptibility tests, Am Soc Microbiol News 58:368, 1992; CLSI M100-S25 guideline Appendix A, 2015.

Data Review

Recognition of unusual resistance profiles is primarily accomplished by carefully reviewing the daily laboratory susceptibility data. Examples of unusual susceptibility profiles for gram-positive and gram-negative bacteria are given in Table 11-7. The examples are a mixture of profiles that clearly demonstrate a likely error (i.e., clindamycin-resistant, erythromycin-susceptible staphylococci); profiles that have rarely been encountered but if observed require immediate attention (i.e., vancomycin resistance in staphylococci); and profiles that have been described but may not be common (i.e., imipenem resistance in Enterobacteriaceae). The data review process for the evaluation of profiles should not be the responsibility of a single person in the laboratory. Furthermore, the process requires checks and balances that do not impede workflow or increase the time required to get the results to the physicians. The way this is established varies, depending on a particular laboratory’s division of labor and workflow, but several key aspects must be considered: • Identification of the organism must be known. To evaluate the accuracy of a susceptibility profile, identification and susceptibility data must be simultaneously analyzed in a timely fashion. Without knowing the organism’s identification, it is typically difficult to determine whether the susceptibility profile is unusual.

• Susceptibility results should be analyzed and reported as early in the day as possible. The workflow should allow time for corrective action for errors found during data review so corrected, or substantiated, results can be provided to physicians as soon as possible. • Two or more tiers of data review should be used. The first tier is at the bench level, where technologists are simultaneously reading the results and evaluating an organism’s susceptibility profile for appropriateness. When unusual profiles are found, the technologist should initiate troubleshooting protocols (see the next section). To prevent release of erroneous and potentially dangerous information, results should not be reported at this point. Review at this level, which is greatly facilitated by automated expert review systems, maintains proficiency among technologists in relationship to the nuances of susceptibility profiles and important resistance patterns. The second tier is at the level of supervisor or laboratory director. The purpose of review at this level is to track and monitor the efficiency of the first tier, to take ultimate responsibility for the accuracy of results, to provide constructive and educational feedback to the technologists performing the first-line review, and to provide guidance for resolution of the unusual profiles. Again, a computer-based review process that searches all reports for predefined unusual

CHAPTER 11  Laboratory Methods and Strategies for Antimicrobial Susceptibility Testing

profiles (similar to those outlined in Table 11-7) can greatly enhance the efficiency and accuracy of the second level of review. • The review process must be flexible and continuously updated. Because bacterial capabilities for antimicrobial resistance profiles change, laboratory resistance detection systems can become outdated. Therefore the list of unusual profiles requires periodic review and updating. Resolution

The importance of having strategies for resolving unusual profiles cannot be overstated. However, developing detailed procedures for every contingency is not possible or practical. Most resolution strategies should focus on certain general approaches, with supervisor or laboratory director consultation always being among the options available to technologists. Although the steps taken to investigate and resolve an unusual profile often depend on the organism and antibiotics involved, most protocols for resolution should include one or more of the following approaches: • Review the data for a possible clerical error. • Verify the susceptibility panel and identification system were inoculated with same isolate. • Reexamine the test panel or plate for a reading error (e.g., misreading of actual zone of inhibition). • Confirm the purity of the inoculum and proper inoculum preparation. • For commercial systems, determine whether the manufacturer’s recommended procedures were followed. • Establish the accuracy of organism identification. • Confirm resistance by using a second method or screening test. Often a quick review of the data recording and interpretation aspects, or purity of culture, will reveal the reason an unusual profile was obtained. Other times more extensive testing, perhaps by more than one method, may be needed to establish the validity of an unusual or unexpected resistance profile.

Accuracy and Antimicrobial Resistance Surveillance Antimicrobial resistance surveillance involves tracking susceptibility profiles produced by the bacteria encountered in a particular institution and in a specific geographic location (i.e., regionally, nationally, or internationally). For laboratories that serve a particular institution or group of institutions, periodic publication of an antibiogram report containing susceptibility data is the extent of the surveillance program (CLSI document M39). These reports, which may be further organized in various ways (e.g., according to hospital location, site of infection, outpatient or inpatient, duration of hospital stay), provide valuable information for monitoring emerging resistance trends among the local microbial flora. Such information is also helpful for establishing empiric therapy guidelines (i.e., therapy that is instituted before knowledge of the infecting organism’s identification

203

or its antimicrobial susceptibility profile), detecting areas of potential inappropriate or excessive antimicrobial use, and contributing data to larger, more extensive surveillance programs. Data that have been validated through a results review and resolution program not only enhance the reliability of laboratory reports for patient management, but also strengthen the credibility of susceptibility data used for resistance surveillance and antibiogram profiling. Therefore meeting the need for each institution to scrutinize susceptibility profiles daily can be accomplished by establishing a results review and resolution format that ensures the accuracy for patient management, detects emerging resistance patterns quickly, and maintains accuracy of the data included in the summary antibiogram reports.

Communication Susceptibility testing profiles produced for each bacterial isolate are typically reported to the physician as a listing of the antimicrobial agents, with each agent accompanied by the category interpretation of susceptible, intermediate, or resistant. In most instances, this reporting approach is sufficient. However, as resistance profiles and their underlying mechanisms become more varied and complex, laboratory personnel must ensure that the significance of susceptibility data is clearly and accurately communicated to clinicians in a way that optimizes both patient care and antimicrobial use. In many situations, passively communicating the susceptibility data to the physician without adding comments or appropriately amending the reports is no longer sufficient. Moreover, the categories of susceptible-dose dependent and nonsusceptible may require conversations between microbiology laboratory professionals, infectious disease physicians, and pharmacy staff members. For example, methicillin-resistant staphylococci are to be considered cross-resistant to all beta-lactams, but in vitro results occasionally may indicate susceptibility to certain cephalosporins, beta-lactam/beta-lactamase inhibitor combinations, or imipenem. Simply reporting these findings without editing such profiles to reflect probable resistance to all beta-lactams would be seriously misleading. As another example, serious enterococcal infections often require combination therapy, including both a cell wall–active agent (ampicillin or vancomycin) and an aminoglycoside (i.e., gentamicin). This important information would not be conveyed in a report that simply lists the agents and their interpretive category results. Such an approach can leave the false impression that a “susceptible” result for any single agent indicates that one drug used alone provides appropriate therapy. Therefore an explanatory note that clearly states the recommended use of combination therapy should accompany the enterococcal susceptibility report. To prevent misinterpretations that may result by providing only antimicrobial susceptibility data, strategies must consider organism antimicrobial combinations that may require reporting of supplemental messages to the physician.

204 PA RT I I  General Principles in Clinical Microbiology

Consultations with infectious disease specialists and other members of the medical staff are an important part of determining when such messages are needed and what the content should include. Finally, if a laboratory does not have the means to reliably relay these messages, either by computer or by paper, a policy of direct communication with the attending physician by telephone or in person should be established.   Visit the Evolve site for a complete list of procedures, review questions, and case study answers.

CASE STUDY 11-1 A 28-year-old man presented to the emergency department (ED) complaining of painful urination and purulent urethral discharge. The patient was empirically treated with singles doses of ciprofloxacin and azithromycin before discharge. A subsequent nucleic acid amplification test showed a positive result for Neisseria gonorrhoeae. Two days later the patient returned to the ED because his symptoms had not resolved. A culture was collected and submitted to the microbiology laboratory. The etiologic agent was identified as N. gonorrhoeae. Antimicrobial susceptibility testing yielded the following results: ceftriaxone—susceptible; ciprofloxacin—resistant; tetracycline—susceptible.

Questions 1. Why don’t clinical laboratories routinely perform antimicrobial susceptibility tests for N. gonorrhoeae? 2. Why would the physician be interested in culture and antimicrobial susceptibility test results on the patient’s specimen? 3. If susceptibility testing is not routinely performed, how is resistance to fluoroquinolones and other antimicrobial agents monitored with N. gonorrhoeae? (See www.cdc.gov/std/ gonorrhea/arg/basic.htm.)

CASE STUDY 11-2 A 32-year-old pregnant woman is screened for group B streptococcus carriage in the third trimester. Group B streptococci was present.

Questions 1. Would antimicrobial susceptibility tests be done routinely in this scenario? 2. Give a reason susceptibility tests may be needed for this situation. 3. If the isolate was found to be erythromycin resistant, what additional testing should be done?

Reference 1. Bauer AW, Kirby WM, Sherris JC, et al: Antibiotic susceptibility testing by a single disc method, Am J Clin Pathol 45:49, 1966.

Bibliography Clinical and Laboratory Standards Institute (CLSI): Methods for determining bactericidal activity of antimicrobial agents: approved guideline M26-A, Wayne, Pa, 1999, CLSI. Clinical and Laboratory Standards Institute (CLSI): Methods for dilution antimicrobial susceptibility testing for bacteria that grow aerobically: M07-A10, Wayne, Pa, 2015, CLSI. Clinical and Laboratory Standards Institute (CLSI): Methods for antimicrobial dilution and disk susceptibility testing of infrequently isolated or fastidious bacteria, ed 3, M45, Wayne, Pa, 2015, CLSI. Clinical and Laboratory Standards Institute (CLSI): Analysis and presentation of cumulative antimicrobial susceptibility test data: approved guideline—M39-A4, Wayne, Pa, 2014, CLSI. Clinical and Laboratory Standards Institute (CLSI): Performance standards for antimicrobial disk susceptibility testing: M02-A12, Wayne, Pa, 2015, CLSI. Clinical and Laboratory Standards Institute (CLSI): Performance standards for antimicrobial susceptibility testing; 25th Information supplement. M100-S25, Wayne, Pa, 2015, CLSI. Courvalin P: Interpretive reading of antimicrobial susceptibility tests, Am Soc Microbiol News 58:368, 1992. CDC Grand Rounds: The growing threat of multidrug-resistant gonorrhea. MMWR 62:103-106, 2013. Ohnishi M, Saika T, Hoshira S, et al: Ceftriaxone-resistant Neisseria gonorrhoeae, Japan Emerg Infect Dis 17:148-149, 2011. Cunningham SA, Noorle T, Meunier D, et al: Rapid and simultaneous detection of genes encoding Klebsiella pneumoniae carbapenemase (blaKPC) and New Delhi metallo-b-lactamase (blaNDM) in gram-negative bacilli, J Clin Microbiol 51:1269-1271, 2013. Girlich D, Polrel L, Nordmann P: Value of the modified Hodge test for detection of emerging carbapenemases in Enterobacteriaceae, J Clin Microbiol 50:477-479, 2012. Laudano JB: Ceftaroline fosamil: a new broad-spectrum cephalosporin. Review, J Antimicrob Chemother 66(Suppl 3):iii11-iii18, 2011. Nordmann P, Poirel L, Dortet L: Rapid detection of carbapenemaseproducing Enterobacteriaceae, Emerg Inf Dis 18(9), 2012. http:// dx.doi.org/10.3201/eid1809.120355. Prabhu K, Rao S, and Rao V: Inducible clindamycin resistance in Staphylococcus aureus isolated from clinical samples, J Lab Physicians 3:25-27, 2011. Singhal N, Kumar M, Kanaujia PK, Virdi JS: MALDI-TOF mass spectrometry: an emerging technology for microbial identification and diagnosis, Front Microbiol 6:791, 2015. Vasoo S, Cunningham SA, Kohner PC, et al: Comparison of a novel, rapid chromogenic biochemical assay, the Carba NP test, with the modified Hodge test for detection of carbapenemase-producing gram-negative bacilli, J Clin Microbiol 51:3097-3101, 2013.

PART I I I  Bacteriology SECTION 1   Principles of Identification

12

Overview of Bacterial Identification Methods and Strategies OBJECTIVES This chapter provides an overview of some of the traditional biochemical methods (rapid and culture based) used to identify microorganisms. Additional tests for specific organisms are included throughout the text. Students and practitioners should use these detailed technical procedures in conjunction with specific chapters in this section to develop a clear understanding of the full laboratory diagnostic process from specimen collection to identification. General objectives for the methods presented in this chapter include the following: 1. State the specific diagnostic purpose for each test methodology. 2. Briefly describe the test principle associated with each test methodology. 3. Outline limitations and explain ways to troubleshoot or report results in the event the test result indicates a false positive or false negative or is equivocal. 4. State the appropriate quality control organisms and results used with each testing procedure.

Rationale for Approaching Organism Identification Effectively presenting and teaching diagnostic microbiology in a way that is sufficiently comprehensive and yet not excessively cluttered with rare and seldom-needed facts about bacterial species that are uncommonly encountered can be challenging. The chapters included in Part III, Bacteriology, are intended to be comprehensive in terms of the variety of bacterial species presented. However, it is helpful to keep in perspective which taxa are most likely to be encountered in the clinical environment and associated with specific anatomic sites of infection. Many texts (including this one) provide flow charts containing algorithms or identification schemes for organism

workup. Although these are helpful, these flow charts have limitations. In some cases they may be too general to be helpful; that is, they may lack sufficient detail to be useful for discriminating among key microbial groups and species. In other cases, they may be too esoteric to be of practical use in routine clinical practice (e.g., identification schemes based on cellular analysis of fatty acid analysis). In addition, many other criteria that must be incorporated into the identification process are too complex to be included in most flow charts. Microorganisms are biologically active living things and therefore are able to alter their biochemical activity and expression of that activity under a variety of environmental stresses. Therefore it is important to note that flow charts are limited based on the inability to adjust for inherent organismal variability and thus are only one of many tools used in the field of diagnostic microbiology. In addition, as discussed later in this chapter, organism taxonomy and profiles continuously change. Detailed flow charts are at risk of quickly becoming outdated. Furthermore, as is evident throughout the chapters in Part III, diagnostic microbiology is full of exceptions to rules, and flow charts are not constructed in a manner that readily captures many of the important exceptions. To meet the challenges of bacterial identification processes beyond what can be portrayed in flow charts, the chapters in Part III have been arranged to guide the student and practicing professional through the entire workup of a microorganism, beginning with the microscopic characteristics and initial culture or growth of the isolates from the clinical specimen. In many instances, the first information a microbiologist uses in the identification process is the microscopic characteristics of the organism and the clinical specimen (Chapter 6). This information guides the clinician to initiate immediate therapy for lifethreatening infections until additional characterization or organismal identification is complete. In most instances, 205

206 PA RT I I I   Bacteriology

the microscopic information a microbiologist uses in the identification process is followed by a macroscopic description of the colony, or colony morphology. This includes the type of hemolysis (if any), pigment (if present), size, texture (opaque, translucent, or transparent), adherence to agar, pitting of agar, and many other characteristics (Chapter 7). After careful observation of the colony, the Gram stain or additional microscopy may be used to validate or separate the organism identification into a variety of broad categories based on Gram stain reaction and the cellular morphology of gram-positive or gram-negative bacteria (e.g., gram-positive cocci, gram-negative rods; Chapter 6). For gram-positive organisms, the catalase test should follow the Gram stain, and testing on gram-negative organisms should begin with the oxidase test. These simple tests, plus growth on MacConkey agar if the isolate is a gram-negative rod or coccobacillus, help the microbiologist assign the organism to one of the primary categories (organized here as subsections). Application of the various identification methods and systems outlined in this chapter generate the data and criteria discussed in each chapter for the definitive identification of clinically relevant bacteria. Many of the rapid biochemical or culture-based procedures described in the following chapters can be found in this chapter. However, additional test methods and rapid commercial identification systems are also available for a variety of organisms and are included in the specific chapters throughout Part III. In this chapter, each procedure includes a photograph of positive and negative reactions. Chapter 6 includes photographs of some commonly used bacteriologic stains. Because diagnostic microbiology is centered around the identification of organisms based on common phenotypic traits shared with known members of the same genus or family, microbiologists “play the odds” every day by finding the best biochemical “fit” and assigning the most probable identification. For example, the gram-negative rod Neisseria animaloris may be considered with either MacConkey-positive or MacConkeynegative organisms in contrast to other Neisseria species, because it grows on MacConkey agar 50% of the time. Therefore, although classified as oxidase-positive, MacConkey-positive, gram-negative bacilli and coccobacilli in this text, it also may appear as an oxidase-positive, MacConkey-negative, gramnegative bacilli and coccobacilli. This example clearly demonstrates the limitations of solely depending on flow charts for the identification process.

The identification process often can be arduous and a drain on resources. Laboratorians must make every effort to identify only those organisms most likely to be involved in the infection process. To that end, the chapters in Part III have also been designed to provide guidance for determining whether a clinical isolate is relevant and requires full identification. Furthermore, the clinical diagnosis and the source of the specimen can help determine which group of organisms to consider. For example, if a patient has endocarditis or the specimen source is blood and a small, gram-negative rod is observed on Gram stain, the microbiologist should consider a group of gramnegative bacilli known as HACEK (Haemophilus spp., Aggregatibacter spp., Cardiobacterium spp., Eikenella corrodens, and Kingella spp.). Similarly, if a patient has suffered an animal bite, the microbiologist should think of Pasteurella multocida if the isolate is gram negative and Staphylococcus hyicus and Staphylococcus intermedius if the organism is gram positive. Finally, in consideration of an isolate’s clinical relevance, each chapter also provides information on whether antimicrobial susceptibility testing is indicated and, if needed, the way it should be performed.

Future Trends of Organism Identification Several dynamics are involved in clinical microbiology and infectious diseases that continue to challenge bacterial identification practices. For instance, new species associated with human infections will continue to be discovered, and well-known species may alter their expression of biochemical characteristics, affecting the criteria used to identify them. For these reasons, identification schemes and strategies for both conventional methods and commercial systems must be continually reviewed and updated. Also, although most identification schemes are based on the phenotypic characteristics of bacteria, the use of molecular and advanced chemical methods (e.g., matrixassisted laser desorption ionization time-of-flight mass spectrometry) to detect, identify, and characterize bacteria continues to expand and play a greater role in diagnostic microbiology. In addition, phenotypic, molecular, and advanced chemical methods increasingly will become incorporated into simpler automated systems. Visit the Evolve site for a complete list of procedures, review questions, and case study answers.

CHAPTER 12  Overview of Bacterial Identification Methods and Strategies

PROCEDURE 12-1

Acetamide Utilization Purpose

Quality Control

Differentiate microorganisms based on the ability to use acetamide as the sole source of carbon.

Positive: Pseudomonas aeruginosa (ATCC 27853)—growth; blue color Negative: Escherichia coli (ATCC 25922)—no growth; green color

Principle Bacteria capable of growth on this medium produce the enzyme acylamidase, which deaminates acetamide to release ammonia. The production of ammonia results in an alkaline pH, causing the medium to change color from green to royal blue. Media: NaCl (5 g), NH4H2PO4 (1 g), K2HPO4 (1 g), agar (15 g), bromothymol blue indicator (0.8 g) per 1000 mL, acetamide (10 g), pH 6.8. Note: The media may be an agar as pictured here or a broth.

A

B

Method 1. Inoculate acetamide slant with a needle using growth from an 18- to 24-hour culture. Do not inoculate from a broth culture, because the growth will be too heavy. 2. Incubate aerobically at 35°C to 37°C for up to 4 days. If equivocal, the slant may be reincubated for 2 additional days.

Expected Results Positive: Deamination of the acetamide, resulting in a blue color (Figure 12-1, A). Negative: No color change (Figure 12-1, B).

Limitations Growth without a color change may indicate a positive test result. If further incubation results in no color change, repeat test with less inoculum.

• Figure 12-1  Acetamide utilization. A, Positive. B, Negative.

207

208 PA RT I I I  Bacteriology

PROCEDURE 12-2

Acetate Utilization Purpose

Quality Control

Differentiate organisms based on ability to use acetate as the sole source of carbon. Generally used to differentiate Shigella spp. from Escherichia coli.

Positive: Escherichia coli (ATCC 25922)—growth; blue Negative: Shigella sonnei (ATCC 25931)—small amount of growth; green

Principle This test is used to differentiate an organism capable of using acetate as the sole source of carbon. Organisms capable of using sodium acetate grow on the medium, resulting in an alkaline pH, turning the indicator from green to blue. Media: NaC2H3O2 (2 g); MgSO4 (0.1 g); NaCl (5 g); NH4H2PO4 (1 g); agar (20 g); bromothymol blue indicator (0.8 g) per 1000 mL, pH 6.7.

A

B

Method 1. With a straight inoculating needle, inoculate acetate slant lightly from an 18- to 24-hour culture. Do not inoculate from a broth culture, because the growth will be too heavy. 2. Incubate at 35°C to 37°C for up to 7 days.

Expected Results Positive: Medium becomes alkalinized (blue) as a result of the growth and use of acetate (Figure 12-2, A). Negative: No growth or growth with no indicator change to blue (Figure 12-2, B).

Limitations Some strains of E. coli may use acetate at a very slow rate or not at all, resulting in a false negative reaction in the identification process.

• Figure 12-2  Acetate utilization. A, Positive. B, Negative.

CHAPTER 12  Overview of Bacterial Identification Methods and Strategies

PROCEDURE 12-3 l-Alanine-7-amido-4-methylcourmarin (Gram-Sure)

Purpose

Limitations

This test is used in conjunction with the Gram stain to distinguish aerobic gram-positive rods or coccobacilli that may appear gram-negative or gram-variable.

Obligate anaerobic organisms may fail to give expected results.

Principle The compound l-Alanine-7-amido-4-methylcourmarin is impregnated in a commercially prepared disk (Remel-Thermo Fisher Scientific, Lenexa, KS). Gram-negative organisms produce an aminopeptidase that is capable of hydrolyzing the reagent in the disk, forming a blue fluorescent compound that is visible under long-wave UV light.

Quality Control Positive: Escherichia coli (ATCC 25922)—blue fluorescence (Figure 12-3, A) Negative: Staphylococcus aureus (ATCC 25923)—no fluorescence (Figure 12-3, B)

A

B

Method 1. Inoculate a pure colony of overnight growth (16 to 18 hours after initial culture) to 0.25 mL of demineralized water in a clean 12 by 75 mm test tube. 2. Place a Gram-Sure disk in the emulsion. 3. Incubate at room temperature for 5 to 10 minutes. 4. Observe blue fluorescence by placing the tube under long-wave ultraviolet light.

Expected Results Aerobic, gram-negative rods and coccobacilli will appear fluorescent or blue. Aerobic, gram-positive rods and coccobacilli will appear colorless.

• Figure 12-3  l-Alanine-7-amido-4-methylcoumarin (Gram-Sure). A, Positive. B, Negative.

209

210 PA RT I I I  Bacteriology

PROCEDURE 12-4

Bacitracin Susceptibility Purpose

Quality Control

This test is used for presumptive identification and differentiation of beta-hemolytic group A streptococci (Streptococcus pyogenes– susceptible) from other beta-hemolytic streptococci. It is also used to distinguish staphylococci species (resistant) from micrococci (susceptible).

Positive: Streptococcus pyogenes (ATCC19615)—susceptible Micrococcus luteus (ATCC10240)—susceptible Negative: Streptococcus agalactiae (ATCC27956)—resistant Staphylococcus aureus (ATCC25923)—resistant

Principle The antibiotic bacitracin inhibits the synthesis of bacterial cell walls. A disk (TaxoA) impregnated with a small amount of bacitracin (0.04 units) is placed on an agar plate, allowing the antibiotic to diffuse into the medium and inhibit the growth of susceptible organisms. After incubation, the inoculated plates are examined for zones of inhibition surrounding the disks.

Method 1. Using an inoculating loop, streak two or three suspect colonies of a pure culture onto a blood agar plate. 2. Using heated forceps, place a bacitracin disk in the first quadrant (area of heaviest growth). Gently tap the disk to ensure adequate contact with the agar surface. 3. Incubate the plate for 18 to 24 hours at 35°C to 37°C in ambient air for staphylococci and in 5% to 10% carbon dioxide (CO2) for streptococci differentiation. 4. Look for a zone of inhibition around the disk.

Expected Results Positive: Any zone of inhibition greater than 10 mm; susceptible (Figure 12-4, A). Negative: No zone of inhibition; resistant (Figure 12-4, B).

Limitations Performance depends on the integrity of the disk. Proper storage and expiration dates should be maintained.

• Figure 12-4  Bacitracin (A disk) susceptibility. Any zone of inhibition is positive (Streptococcus pyogenes); growth up to the disk is negative (Streptococcus agalactiae).

CHAPTER 12  Overview of Bacterial Identification Methods and Strategies

PROCEDURE 12-5

Bile Esculin Test Purpose

Limitations

This test is used for the presumptive identification of enterococci and organisms in the Streptococcus bovis group. The test differentiates enterococci and group D streptococci from non–group D viridans streptococci.

As a result of nutritional requirements, some organisms may grow poorly or not at all on this medium.

Principle Gram-positive bacteria other than some streptococci and enterococci are inhibited by the bile salts in this medium. Organisms capable of growth in the presence of 4% bile and able to hydrolyze esculin to esculetin will demonstrate growth. In addition, esculetin reacts with Fe31 and forms a dark brown to black precipitate. Media: Beef extract (11 g), enzymatic digest of gelatin (34.5 g), esculin (1 g), ox bile (2 g), ferric ammonium citrate (0.5 g), agar (15 g) per 1000 mL, pH 6.6.

Quality Control Positive: Enterococcus faecalis (ATCC19433)—growth; black precipitate Negative: Escherichia coli (ATCC25922)—growth; no color change Streptococcus pyogenes (ATCC19615)—no growth; no color change

A

B

Method 1. Inoculate one to two colonies from an 18- to 24-hour culture onto the surface of the slant. 2. Incubate at 35°C to 37°C in ambient air for 48 hours.

Expected Results Positive: Growth and blackening of the agar slant (Figure 12-5, A). Negative: Growth and no blackening of medium (Figure 12-5, B). No growth (not shown).

• Figure 12-5  Bile esculin agar. A, Positive. B, Negative.

PROCEDURE 12-6

Bile Solubility Test Purpose

Limitations

This test differentiates Streptococcus pneumoniae (positive; soluble) from alpha-hemolytic streptococci (negative; insoluble).

Enzyme activity may be reduced in old cultures. Therefore negative results with colonies resembling S. pneumoniae should be further tested for identification with alternate methods.

Principle Bile or a solution of a bile salt (e.g., sodium deoxycholate) rapidly lyses pneumococcal colonies. Lysis depends on the presence of an intracellular autolytic enzyme, amidase. Bile salts lower the surface tension between the bacterial cell membrane and the medium, thus accelerating the organism’s natural autolytic process.

Quality Control Positive: Streptococcus pneumoniae (ATCC49619)—bile soluble Negative: Enterococcus faecalis (ATCC29212)—bile insoluble

Method 1. After 12 to 24 hours of incubation on 5% sheep blood agar, place one to two drops of 10% sodium deoxycholate on a well-isolated colony. Note: A tube test is performed with 2% sodium deoxycholate. 2. Gently wash liquid over the colony without dislodging the colony from the agar. 3. Incubate the plate at 35°C to 37°C in ambient air for 30 minutes. 4. Examine for lysis of colony.

Expected Results Positive: Colony disintegrates; an imprint of the lysed colony may remain in the zone (Figure 12-6, A). Negative: Intact colonies (Figure 12-6, B).

B

A

• Figure 12-6  Bile solubility (deoxycholate) test. A, Colony lysed. B, Intact colony.

211

212 PA RT I I I  Bacteriology

PROCEDURE 12-7

Butyrate Disk (Catarrhalis Test) Purpose

4. Incubate at room temperature for up to 5 minutes.

This is a rapid test to detect the enzyme butyrate esterase, to aid identification of Moraxella catarrhalis.

Expected Results Positive: Development of a blue color during the 5-minute incubation period (Figure 12-7, A). Negative: No color change (Figure 12-7, B).

Principle Organisms capable of producing butyrate esterase hydrolyze bromo-chlor-indolyl butyrate. Hydrolysis of the substrate in the presence of butyrate esterase releases indoxyl, which in the presence of oxygen spontaneously forms indigo, a blue to blue-violet color.

Limitations

Method 1. Remove a disk from the vial and place on a glass microscope slide. 2. Add one drop of reagent-grade water. This should leave a slight excess of water on the disk. 3. Using a wooden applicator stick, rub a small amount of several colonies from an 18- to 24-hour pure culture onto the disk.

Incubation longer than 5 minutes may result in a false-positive reaction. False-negative reactions may occur if the inoculum is too small. If the organism is negative, repeat with a larger inoculum and follow up with additional methods.

Quality Control Positive: Moraxella catarrhalis (ATCC25240)—formation of blue color Negative: Neisseria gonorrhoeae (ATCC43069)—no color change

A

• Figure 12-7  Butyrate disk. A, Positive. B, Negative.

B

CHAPTER 12  Overview of Bacterial Identification Methods and Strategies

PROCEDURE 12-8

CAMP Test Purpose

Limitations

The Christie, Atkins, and Munch-Peterson (CAMP) test is used to differentiate group B streptococci (Streptococcus agalactiae– positive) from other streptococcal species. Listeria monocytogenes also produces a positive CAMP reaction.

A small percentage of group A streptococci may have a positive CAMP reaction. The test should be limited to colonies with the characteristic group B streptococci morphology and narrow-zone beta-hemolysis on sheep blood agar.

Principle

Quality Control

Certain organisms (including group B streptococci) produce a diffusible extracellular hemolytic protein (CAMP factor) that acts synergistically with the beta-lysin of Staphylococcus aureus to cause enhanced lysis of red blood cells. The group B streptococci are streaked perpendicular to a streak of S. aureus on sheep blood agar. A positive reaction appears as an arrowhead zone of hemolysis adjacent to the place where the two streak lines come into proximity.

Positive: Streptococcus agalactiae (ATCC13813)—enhanced arrowhead hemolysis Negative: Streptococcus pyogenes (ATCC19615)—beta-hemolysis without enhanced arrowhead formation

Method 1. Streak a beta-lysin–producing strain of S. aureus down the center of a sheep blood agar plate. 2. Streak test organisms across the plate perpendicular to the S. aureus streak within 2 mm. (Multiple organisms can be tested on a single plate.) 3. Incubate overnight at 35° to 37°C in ambient air.

A

B

Expected Results Positive: Enhanced hemolysis is indicated by an arrowheadshaped zone of beta-hemolysis at the juncture of the two organisms (Figure 12-8, A). Negative: No enhancement of hemolysis (Figure 12-8, B).

• Figure 12-8  Christie,

Atkins, and Munch-Peterson (CAMP) test. A, Positive; arrowhead zone of beta-hemolysis (at arrow), typical of group B streptococci. B, Negative; no enhancement of hemolysis.

213

214 PA RT I I I  Bacteriology

PROCEDURE 12-9

Catalase Test Purpose This test differentiates catalase-positive micrococcal and staphylococcal species from catalase-negative streptococcal species.

Principle Aerobic and facultative anaerobic organisms produce two toxins during normal metabolism, hydrogen peroxide (H2O2) and superoxide radical (O22). These bacteria have two enzymes that detoxify the products of normal metabolism. One of these enzymes, catalase, is capable of converting hydrogen peroxide to water and oxygen. The presence of the enzyme in a bacterial isolate is evidenced when a small inoculum introduced into hydrogen peroxide (30% for the slide test) causes rapid elaboration of oxygen bubbles. The lack of catalase is evident by a lack of or weak bubble production.

2. Place a drop of 30% hydrogen peroxide (H2O2) onto the medium. (3% can also be used for most organisms.) 3. Observe for the evolution of oxygen bubbles (Figure 12-9).

Expected Results Positive: Copious bubbles are produced (Figure 12-9, A). Negative: No or few bubbles are produced (Figure 12-9, B).

Limitations Some organisms (enterococci) produce a peroxidase that slowly catalyzes the breakdown of H2O2, and the test may appear weakly positive. This reaction is not a truly positive test. False positives may occur if the sample is contaminated with blood agar.

Quality Control Positive: Staphylococcus aureus (ATCC25923) Negative: Streptococcus pyogenes (ATCC19615)

Method 1. Use a loop or sterile wooden stick to transfer a small amount of colony growth to the surface of a clean, dry glass slide.

• Figure 12-9  Catalase test. A, Positive. B, Negative.

CHAPTER 12  Overview of Bacterial Identification Methods and Strategies

PROCEDURE 12-10

Cetrimide Agar Purpose This test is primarily used to isolate and purify Pseudomonas aeruginosa from contaminated specimens.

Principle The test is used to determine the ability of an organism to grow in the presence of cetrimide, a toxic substance that inhibits the growth of many bacteria by causing the release of nitrogen and phosphorous, which slows or kills the organism. P. aeruginosa is resistant to cetrimide. Media: Enzymatic digest of gelatin (20 g), MgCl2 (1.4 g), K2SO4 (10 g), cetrimide (cetyltrimethylammonium bromide) (0.3 g), agar (13.6), pH 7.2.

Additional testing is necessary to confirm a diagnosis of P. aeruginosa.

Quality Control Positive: Pseudomonas aeruginosa (ATCC27853)—growth and color change; yellow-green to blue-green colonies Negative: Escherichia coli (ATCC25922)—no growth and no color change

A

B

Method 1. Inoculate a cetrimide agar slant with one drop of an 18- to 24-hour brain-heart infusion broth culture. 2. Incubate at 35°C to 37°C for up to 7 days. 3. Examine the slant for bacterial growth.

Expected Results Positive: Growth, variation in color of colonies (Figure 12-10, A). Negative: No growth (Figure 12-10, B).

Limitations Some enteric organisms will grow and exhibit a weak yellow color in the media. This color change is distinguishable from the production of fluorescein.

• Figure 12-10  Cetrimide agar. A, Positive. B, Negative.

215

216 PA RT I I I  Bacteriology

PROCEDURE 12-11

Citrate Utilization Purpose

Limitations

The purpose of this test is to identify organisms capable of using sodium citrate as the sole carbon source and inorganic ammonium salts as the sole nitrogen source. The test is part of a series referred to as IMViC (indole, methyl red, Voges-Proskauer, and citrate), which is used to differentiate Enterobacteriaceae from other gram-negative rods.

Some organisms are capable of growth on citrate and do not produce a color change. Growth is considered a positive citrate utilization test, even in the absence of a color change.

Principle Bacteria that can grow on this medium produce an enzyme, citrate-permease, capable of converting citrate to pyruvate. Pyruvate can then enter the organism’s metabolic cycle for the production of energy. Bacteria capable of growth in this medium use the citrate and convert ammonium phosphate to ammonia and ammonium hydroxide, creating an alkaline pH. The pH change turns the bromothymol blue indicator from green to blue. Media: NH4H2PO4 (1 g), K2HPO4 (1 g), NaCl (5 g), sodium citrate (2 g), MgSO4 (0.2 g), agar (15 g), bromothymol blue (0.08 g) per 1000 mL, pH 6.9.

Quality Control Positive: Enterobacter aerogenes (ATCC13048)—growth; blue color Negative: Escherichia coli (ATCC25922)—little to no growth; no color change

A

B

Method 1. Inoculate Simmons citrate agar lightly on the slant by touching the tip of a needle to a colony that is 18 to 24 hours old. Do not inoculate from a broth culture, because the inoculum will be too heavy. 2. Incubate at 35°C to 37°C for up to 7 days. 3. Observe for growth and the development of blue color, denoting alkalinization.

Expected Results Positive: Growth on the medium, with or without a change in the color of the indicator. Growth typically results in the bromothymol blue indicator turning from green to blue (Figure 12-11, A). Negative: Absence of growth (Figure 12-11, B).

• Figure 12-11  Citrate utilization. A, Positive. B, Negative.

CHAPTER 12  Overview of Bacterial Identification Methods and Strategies

PROCEDURE 12-12

Coagulase Test Purpose The test is used to differentiate Staphylococcus aureus (positive) from coagulase-negative staphylococci (negative).

Principle S. aureus produces two forms of coagulase, bound and free. Bound coagulase, or “clumping factor,” is bound to the bacterial cell wall and reacts directly with fibrinogen. This results in precipitation of fibrinogen on the staphylococcal cell, causing the cells to clump when a bacterial suspension is mixed with plasma. The presence of bound coagulase correlates with free coagulase, an extracellular protein enzyme that causes the formation of a clot when S. aureus colonies are incubated with plasma. The clotting mechanism involves activation of a plasma coagulase-reacting factor (CRF), which is a modified or derived thrombin molecule, to form a coagulase-CRF complex. This complex in turn reacts with fibrinogen to produce the fibrin clot.

Method A. Slide Test (Detection of Bound Coagulase or Clumping Factor)

1. Place a drop of coagulase plasma (preferably rabbit plasma with ethylenediaminetetraacetic acid [EDTA]) reagent on the reaction provided by the manufacturer. 2. Place a drop of distilled water or saline next to the drop of plasma in an adjacent reaction well as a negative control. 3. Place a drop of coagulase plasma reagent in a third adjacent reaction well as a positive control. 4. With a loop, straight wire, or wooden stick, emulsify a portion of the isolated colony being tested in the rabbit plasma reagent. Try to create a smooth suspension. 5. Mix well with a wooden applicator stick. 6. With a loop, straight wire, or wooden stick, emulsify a known Staphylococcus aureus in the positive and negative control wells. 7. Mix all samples well with a new wooden applicator stick for each sample. 8. Rock the slide gently for 5 to 10 seconds.

Expected Results Positive: Macroscopic clumping in 10 seconds or less in coagulated plasma drop positive control, unknown clinical isolate along with no clumping in saline or water drop (Figure 12-12, A, left side). Negative: No clumping in the unknown clinical isolate well as long as the positive and negative controls demonstrate appropriate reactions as described. Note: All negative slide tests must be confirmed using the tube test (Figure 12-12, B, right side).

B. Tube Test (Detection of Free Coagulase)

1. Emulsify several colonies of the unknown clinical isolate in 0.5 mL of rabbit plasma (with EDTA) to give a milky suspension. 2. Repeat the same process with a known positive and negative control organism.

. Incubate tube at 35°C to 37°C in ambient air for 1 to 4 hours. 2 3. Check for clot formation.

Expected Results Positive: Clot of any size (Figure 12-12, A, left side). Negative: No clot (Figure 12-12, B, right side).

Limitations Slide Test

Equivocal: Clumping in both the rabbit plasma reagent and water or saline control drops indicate that the organism autoagglutinates and is unsuitable for the slide coagulase test.

Tube Test

1. Test results can be positive at 1 to 4 hours and then revert to negative after 24 hours. 2. If negative at 4 hours, incubate at room temperature overnight and check again for clot formation.

Quality Control Positive: Staphylococcus aureus (ATCC25923) Negative: Staphylococcus epidermidis (ATCC12228)

A

B • Figure 12-12  Coagulase test. A, Slide coagulase test for clumping

factor. Left side is positive; right side is negative. B, Tube coagulase test for free coagulase. Tube on the left is positive, exhibiting clot. Tube on the right is negative.

217

218 PA RT I I I  Bacteriology

PROCEDURE 12-13

Decarboxylase Tests (Moeller’s Method) Purpose This test is used to differentiate decarboxylase-producing Enterobacteriaceae from other gram-negative rods.

Principle This test measures the enzymatic ability (decarboxylase) of an organism to decarboxylate (or hydrolyze) an amino acid to form an amine. Decarboxylation, or hydrolysis, of the amino acid results in an alkaline pH and a color change from orange to purple. Media: Peptic digest of animal tissue (5 g), beef extract (5 g), bromocresol purple (0.1 g), cresol red (0.005 g), dextrose (0.5 g), pyridoxal (0.005 g), amino acid (10 g), pH 6.0.

Method A. Glucose-Nonfermenting Organisms

1. Prepare a suspension (McFarland No. 5 turbidity standard) in brain-heart infusion broth from an overnight culture (18 to 24 hours old) growing on 5% sheep blood agar. 2. Inoculate each of the three decarboxylase broths (arginine, lysine, and ornithine) and the control broth (no amino acid) with four drops of broth. 3. Add a 4-mm layer of sterile mineral oil to each tube. 4. Incubate the cultures at 35°C to 37°C in ambient air. Examine the tubes at 24, 48, 72, and 96 hours.

about by a positive decarboxylation reaction (Figure 12-13, B). An uninoculated tube is shown in Figure 12-13, C.

Quality Control Positive: Lysine—Klebsiella pneumoniae (ATCC33495)—yellow to purple Ornithine—Enterobacter aerogenes (ATCC13048)—yellow to purple Arginine—Pseudomonas aeruginosa (ATCC27853)—yellow to purple Base Control: Positive Glucose Fermenters Klebsiella pneumoniae (ATCC27736)—yellow Enterobacter aerogenes (ATCC13048)—yellow Negative: Lysine—Citrobacter freundii (ATCC331218)—yellow Ornithine—Proteus vulgaris (ATCC6380)—yellow Arginine—Escherichia coli (ATCC25922)—yellow

A

B

C

B. Glucose-Fermenting Organisms

1. Inoculate tubes with one drop of an 18- to 24-hour brain-heart infusion broth culture. 2. Add a 4-mm layer of sterile mineral oil to each tube. 3. Incubate the cultures for 4 days at 35°C to 37°C in ambient air. Examine the tubes at 24, 48, 72, and 96 hours.

Expected Results Positive: Alkaline (purple) color change compared with the control tube (Figure 12-13, A). Negative: No color change or acid (yellow) color in test and control tube. Growth in the control tube.

Limitations The fermentation of dextrose in the medium causes the acid color change. However, it would not mask the alkaline color change brought

• Figure 12-13  Decarboxylase

tests (Moeller’s method). A, Positive. B, Negative. C, Uninoculated tube.

CHAPTER 12  Overview of Bacterial Identification Methods and Strategies

PROCEDURE 12-14

Deoxyribonucleic Acid Hydrolysis (DNase Test Agar) Purpose

Quality Control

This test is used to differentiate organisms based on the production of deoxyribonuclease. It is used to distinguish Serratia spp. (positive) from Enterobacter spp., Staphylococcus aureus (positive) from other species, and Moraxella catarrhalis (positive) from Neisseria spp.

Positive: Staphylococcus aureus (ATCC25923) Negative: Escherichia coli (ATCC25922)

Principle The test is used to determine the ability of an organism to hydrolyze deoxyribonucleic acid (DNA). The medium is pale green because of the DNA–methyl green complex. If the organism growing on the medium hydrolyzes DNA, the green color fades and the colony is surrounded by a colorless zone. Media: Pancreatic digest of casein (10 g), yeast extract (10 g), deoxyribonucleic acid (2 g), NaCl (5 g), agar (15 g), methyl green (0.5 g), pH 7.5.

Note: Several variations of this media are available that include agarose slants and toluene blue (positive result appears a deep pink) or precipitation of the DNA by flooding with hydrochloric acid resulting in a visible precipitation of the polymerized DNA in the absence of a dye.

Method 1. Inoculate the DNase agar with the organism to be tested and streak for isolation. 2. Incubate aerobically at 35°C to 37°C for 13 to 24 hours.

A

Expected Results Positive: When DNA is hydrolyzed, methyl green is released and combines with highly polymerized DNA at a pH of 7.5, turning the medium colorless around the test organism (Figure 12-14, A and B). Negative: If no degradation of DNA occurs, the medium remains green (Figure 12-14, C).

C

B

Limitations Agar must be inoculated with a suspension of a young broth culture (4 hours old) or an 18- to 24-hour overnight colony in 1 to 2 mL of saline.

• Figure 12-14  Deoxyribonucleic

acid (DNA) hydrolysis. A, Positive, Staphylococcus aureus. B, Positive, Serratia marcescens. C, Negative.

219

220 PA RT I I I  Bacteriology

PROCEDURE 12-15

Esculin Hydrolysis Purpose

Quality Control

This test is used for the presumptive identification and differentiation of Enterobacteriaceae.

Positive: Enterococcus faecalis (ATCC29212) Negative: Escherichia coli (ATCC25922)

Principle This test is used to determine whether an organism is able to hydrolyze the glycoside esculin. Esculin is hydrolyzed to esculetin, which reacts with Fe31 and forms a dark brown to black precipitate. Media: NaCl (8 g), K2HPO4 (0.4 g), KH2PO4 (0.1 g), esculin (5 g), ferric ammonium citrate (0.5 g), agar (15 g) per 1000 mL, pH 7.0.

Method

A

1. Inoculate the medium with one drop of a 24-hour broth culture. 2. Incubate at 35°C to 37°C for up to 7 days. 3. Examine the slants for blackening and, under the ultraviolet rays of a Wood’s lamp, for esculin hydrolysis.

B

Expected Results Positive: Blackened medium (Figure 12-15, A), which would also show a loss of fluorescence under the Wood’s lamp. Negative: No blackening and no loss of fluorescence under the Wood’s lamp, or slight blackening with no loss of fluorescence under the Wood’s lamp. An uninoculated tube is shown in Figure 12-15, B.

Limitations This medium is a nonselective agar. The bile esculin hydrolysis test presented in Procedure 12-5 is a selective differential method.

• Figure 12-15  Esculin B, Uninoculated tube.

hydrolysis. A, Positive, blackening of slant.

CHAPTER 12  Overview of Bacterial Identification Methods and Strategies

PROCEDURE 12-16

Fermentation Media Purpose

Expected Results

Fermentation media are used to differentiate organisms based on their ability to ferment carbohydrates incorporated into the basal medium. Andrade’s formula is used to differentiate enteric bacteria from coryneforms, and bromocresol purple is used to distinguish enterococci from streptococci.

Positive: Indicator change to yellow (Figure 12-16, B, left). Negative: Growth, but no change in color. Medium remains purple (Figure 12-16, B, right).

Principle Carbohydrate fermentation is the process microorganisms use to produce energy. Most microorganisms convert glucose to pyruvate during glycolysis; however, some organisms use alternate pathways. A fermentation medium consists of a basal medium containing a single carbohydrate (glucose, lactose, or sucrose) for fermentation. However, the medium may contain various color indicators, such as Andrade’s indicator, bromocresol, or others. In addition to a color indicator to detect the production of acid from fermentation, a Durham tube is placed in each tube to capture gas produced by metabolism. Basal media: Pancreatic digest of casein (10 g), beef extract (3 g), NaCl (5 g), carbohydrate (10 g), specific indicator (Andrade’s indicator [10 mL, pH 7.4] or bromocresol purple [0.02 g, pH 6.8]).

Method A. Peptone Medium with Andrade’s Indicator (for Enterics and Coryneforms)

1. Inoculate each tube with one drop of an 18- to 24-hour brain-heart infusion broth culture. 2. Incubate at 35°C to 37°C for up to 7 days in ambient air. Note: Tubes are held only 4 days for organisms belonging to the Enterobacteriaceae family. 3. Examine the tubes for acid (indicated by a pink color) and gas production. 4. Tubes must show growth for the test to be valid. If no growth in the fermentation tubes or control is seen after 24 hours of incubation, add one to two drops of sterile rabbit serum per 5 mL of fermentation broth to each tube.

Limitations Readings after 24 hours may not be reliable if no acid is produced. No color change or a result indicating alkalinity may occur if the organism deaminates the peptone, masking the evidence of carbohydrate fermentation.

Quality Control Note: Appropriate organisms depend on which carbohydrate has been added to the basal medium. An example is given for each type of medium.

A. Peptone Medium with Andrade’s Indicator Dextrose: Positive, with gas: Escherichia coli (ATCC25922) Positive, no gas: Shigella flexneri (ATCC12022)

B. Brain-Heart Infusion Broth with Bromocresol Purple Indicator Dextrose: Positive, with gas: Escherichia coli (ATCC25922) Negative, no gas: Moraxella osloensis (ATCC10973)

A

B

Expected Results Positive: Indicator change to pink with or without gas formation in Durham tube (Figure 12-16, A, left and middle). Negative: Growth, but no change in color. Medium remains clear to straw colored (Figure 12-16, A, right).

B. Broth (Brain-Heart Infusion Broth May Be Substituted) with Bromocresol Purple Indicator   (for Streptococci and Enterococci)

1. Inoculate each tube with two drops of an 18- to 24-hour brain-heart infusion broth culture. 2. Incubate 4 days at 35°C to 37°C in ambient air. 3. Observe daily for a change of the bromocresol purple indicator from purple to yellow (acid).

• Figure 12-16  Fermentation media. A, Peptone medium with Andrade’s indicator. The tube on the left ferments glucose with the production of gas (visible as a bubble [arrow] in the inverted [Durham] tube); the tube in the middle ferments glucose with no gas production; and the tube on the right does not ferment glucose. B, Heart infusion broth with bromocresol purple indicator. The tube on the left is positive; the tube on the right is negative.

221

222 PA RT I I I  Bacteriology

PROCEDURE 12-17

Flagella Stain (Wet Mount Technique) Purpose

3. Location of flagella per cell

This technique is used to visualize the presence and arrangement of flagella for the presumptive identification of motile bacterial species.

a. Peritrichous (Figure 12-17, A)

Principle

c. Polar or monotrichous (Figure 12-17, B) d. Amphitrichous

Flagella are too thin to be visualized using a bright field microscope with ordinary stains, such as the Gram stain, or a simple stain. A wet mount technique is used for staining bacterial flagella, and it is simple and useful when the number and arrangement of flagella are critical to the identification of species of motile bacteria. The staining procedures require the use of a mordant so that the stain adheres in layers to the flagella, allowing visualization.

Method 1. Grow the organism to be stained at room temperature on blood agar for 16 to 24 hours. 2. Add a small drop of water to a microscope slide. 3. Dip a sterile inoculating loop into sterile water. 4. Touch the loopful of water to the colony margin briefly (this allows motile cells to swim into the droplet of water). 5. Touch the loopful of motile cells to the drop of water on the slide. Note: Agitating the loop in the droplet of water on the slide causes the flagella to shear off the cell. 6. Cover the faintly turbid drop of water on the slide with a cover slip. A proper wet mount has barely enough liquid to fill the space under a cover slip. Small air spaces around the edge are preferable. 7. Examine the slide immediately under 403 to 503 magni­ fication for motile cells. If motile cells are not seen, do not proceed with the stain. 8. If motile cells are seen, leave the slide at room temperature for 5 to 10 minutes. This allows the bacterial cells time to adhere either to the glass slide or to the cover slip. 9. Gently apply two drops of Ryu flagella stain (available from multiple manufacturers) to the edge of the cover slip. The stain will flow by capillary action and mix with the cell suspension. Small air pockets around the edge of the wet mount are useful in aiding the capillary action. 10. After 5 to 10 minutes at room temperature, examine the cells for flagella. 11. Cells with flagella may be observed at 1003 (oil) magni­ fication in the zone of optimum stain concentration, about halfway from the edge of the cover slip to the center of the mount. 12. Focusing the microscope on the cells attached to the cover slip rather than on the cells attached to the slide facilitates visualization of the flagella. The precipitate from the stain is primarily on the slide rather than the cover slip.

Expected Results Observe the slide and note the following: 1. Presence or absence of flagella 2. Number of flagella per cell

b. Lophotrichous

4. Amplitude of wavelength a. Short b. Long 5. Whether or not “tufted”

Limitations Even with a specific stain, visualization of flagella requires an experienced laboratory scientist and is not considered an entry-level technique.

Quality Control Peritrichous: Escherichia coli Polar: Pseudomonas aeruginosa Negative: Klebsiella pneumoniae

A

B • Figure 12-17  Flagella

stain (wet mount technique). A, Alcaligenes spp., peritrichous flagella (arrows). B, Pseudomonas aeruginosa, polar flagella (arrows).

CHAPTER 12  Overview of Bacterial Identification Methods and Strategies

PROCEDURE 12-18

Gelatin Hydrolysis Purpose The production of gelatinases capable of hydrolyzing gelatin is used as a presumptive test for the identification of various organisms, including Staphylococcus spp., Enterobacteriaceae, and some gram-positive bacilli.

Principle This test is used to determine the ability of an organism to produce extracellular proteolytic enzymes (gelatinases) that liquefy gelatin, a component of vertebrate connective tissue. Nutrient gelatin medium differs from traditional microbiology media in that the solidifying agent (agar) is replaced with gelatin. When an organism produces gelatinase, the enzyme liquefies the growth medium. Media: Enzymatic digest of gelatin (5 g), beef extract (3 g), gelatin (120 g) per 1000 mL, pH 6.8.

Negative: Complete solidification of the tube at 4°C (Figure 12-18, B).

Limitations Some organisms may grow poorly or not at all in this medium. Gelatin is liquid above 20°C; therefore determination of results must be completed after refrigeration.

Quality Control Positive: Bacillus subtilis (ATCC9372) Negative: Escherichia coli (ATCC25922) Uninoculated control tube: medium becomes solid after refrigeration.

Method 1. Inoculate the gelatin deep with four to five drops of a 24-hour broth culture. 2. Incubate at 35°C to 37°C in ambient air for up to 14 days. Note: Incubate the medium at 25°C if the organism grows better at 25°C than at 35°C. 3. Alternatively, inoculate the gelatin deep from a 24-hour-old colony by stabbing four or five times, 0.5 inch into the medium. 4. Remove the gelatin tube daily from the incubator and place at 4°C to check for liquefaction. Do not invert or tip the tube, because sometimes the only discernible liquefaction occurs at the top of the deep where inoculation occurred. 5. Refrigerate an uninoculated control along with the inoculated tube. Liquefaction is determined only after the control has hardened (gelled).

A

B

Expected Results Positive: Partial or total liquefaction of the inoculated tube (the control tube must be completely solidified) at 4°C within 14 days (Figure 12-18, A).

• Figure 12-18  Gelatin hydrolysis. A, Positive; note liquefaction at top of tube. B, Uninoculated tube.

223

224 PA RT I I I  Bacteriology

PROCEDURE 12-19

Growth at 42°C Purpose

Quality Control

This test is used to differentiate a pyocyanogenic pseudomonad from other Pseudomonas spp.

Positive: Pseudomonas aeruginosa (ATCC10145) Negative: Pseudomonas fluorescens (ATCC13525)

Principle

A

The test is used to determine the ability of an organism to grow at 42°C. Several Pseudomonas spp. have been isolated in the clinical laboratory that are capable of growth at elevated temperatures.

B

Method 1. Inoculate two tubes of trypticase soy agar (TSA) with a light inoculum by lightly touching a needle to the top of a single 13- to 24-hour-old colony and streaking the slant. 2. Immediately incubate one tube at 35°C and one at 42°C. 3. Record the presence of growth on each slant after 18 to 24 hours.

Expected Results Positive: Good growth at both 35°C and 42°C (Figure 12-19, A). Negative: No growth at 42°C (Figure 12-19, B), but good growth at 35°C.

• Figure 12-19  Growth at 42°C. A, Positive; good growth. B, Nega-

tive; no growth.

PROCEDURE 12-20

Hippurate Hydrolysis Purpose

Limitations

Production of the enzyme hippuricase is used for the presumptive identification of a variety of microorganisms.

A false-positive result may occur if incubation with ninhydrin exceeds 30 minutes.

Principle

Quality Control

The end products of hydrolysis of hippuric acid by hippuricase include glycine and benzoic acid. Glycine is deaminated by the oxidizing agent ninhydrin, which is reduced during the process. The end products of the ninhydrin oxidation react to form a purple-colored product. The test medium must contain only hippurate, because ninhydrin might react with any free amino acids present in growth media or other broths.

Positive: Streptococcus agalactiae (ATCC12386) Negative: Streptococcus pyogenes (ATCC19615)

Method

A

B

1. Add 0.1 mL of sterile water to a 12 by 75 mm plastic test tube. 2. Make a heavy suspension of the organism to be tested. 3. Using heated forceps, place a rapid hippurate disk in the mixture. 4. Cap and incubate the tube for 2 hours at 35°C; use of a water bath is preferred. 5. Add 0.2 mL ninhydrin reagent and reincubate for an additional 15 to 30 minutes. Observe the solution for the development of a deep purple color.

Expected Results Positive: Deep purple color (Figure 12-20, A). Negative: Colorless or slightly yellow pink color (Figure 12-20, B).

• Figure 12-20  Hippurate hydrolysis. A, Positive. B, Negative.

CHAPTER 12  Overview of Bacterial Identification Methods and Strategies

PROCEDURE 12-21

Indole Production Purpose This test is used to identify organisms that produce the enzyme tryptophanase.

Principle The test is used to determine an organism’s ability to hydrolyze tryptophan to form the compound indole. Tryptophan is present in casein and animal protein. Bacteria with tryptophanase are capable of hydrolyzing tryptophan to pyruvate, ammonia, and indole. Kovac’s reagent (dimethylamine-benzaldehyde and hydrochloride), when added to the broth culture, reacts with the indole, producing a red color. An alternative method uses Ehrlich’s reagent. Ehrlich’s reagent has the same chemicals as the Kovac preparation, but it also contains absolute ethyl alcohol, making it flammable. Ehrlich’s reagent is more sensitive for detecting small amounts of indole. (The spot indole test is described in Procedure 12-40.) Media: Casein peptone (10 g), NaCl (5 g), tryptophan (10 g) per 1000 mL.

Negative: No color change after addition of the appropriate reagent (Figure 12-21, B).

Limitations Ehrlich’s method may also be used to differentiate organisms under anaerobic conditions.

Quality Control A. Kovac’s Method

Positive: Escherichia coli (ATCC25922) Negative: Klebsiella pneumoniae (ATCC13883)

B. Ehrlich’s Method

Positive: Haemophilus influenzae (ATCC49766) Negative: Haemophilus parainfluenza (ATCC76901)

C. Ehrlich’s Method (Anaerobic)

Positive: Porphyromonas asaccharolytica (ATCC25260) Negative: Bacteroides fragilis (ATCC25285)

Method A. Enterobacteriaceae

1. Inoculate tryptophane broth with one drop from a 24-hour brain-heart infusion broth culture. 2. Incubate at 35°C to 37°C in ambient air for 48 hours. 3. Add 0.5 mL of Kovac’s reagent to the broth culture.

A

B

B. Other Gram-Negative Bacilli

1. Inoculate tryptophane broth with one drop of a 24-hour broth culture. 2. Incubate at 35°C to 37°C in ambient air for 48 hours. 3. Add 1 mL of xylene to the culture. 4. Shake the mixture vigorously to extract the indole and allow it to stand until the xylene forms a layer on top of the aqueous phase. 5. Add 0.5 mL of Ehrlich’s reagent down the side of the tube.

Expected Results

Positive: Pink- to wine-colored ring after addition of appropriate reagent (Figure 12-21, A).

• Figure 12-21  Indole production. A, Positive. B, Negative.

225

226 PA RT I I I  Bacteriology

PROCEDURE 12-22

Leucine Aminopeptidase (LAP) Test Purpose

Quality Control

The leucine aminopeptidase (LAP) test is used for the presumptive identification of catalase-negative gram-positive cocci.

Positive: Enterococcus faecalis (ATCC29212)—red color Negative: Aerococcus viridans (ATCC11563)—no color change

Principle The LAP disk is a rapid test for the detection of the enzyme leucine aminopeptidase. Leucine-beta-naphthylamide– impregnated disks serve as a substrate for the detection of leucine aminopeptidase. After hydrolysis of the substrate by the enzyme, the resulting beta-naphthylamine produces a red color upon addition of cinnamaldehyde reagent.

Method

A

1. Before incubation, slightly dampen the LAP disk with reagentgrade water. Do not supersaturate the disk. 2. Using a wooden applicator stick, rub a small amount of several colonies of an 18- to 24-hour pure culture onto a small area of the LAP disk. 3. Incubate at room temperature for 5 minutes. 4. After this incubation period, add one drop of cinnamaldehyde reagent.

B

Expected Results Positive: Development of a red color within 1 minute after adding cinnamaldehyde reagent (Figure 12-22, A; swab test is depicted) Negative: No color change or development of a slight yellow color (Figure 12-22, B).

Limitations The test result depends on the integrity of the substrateimpregnated disk.

• Figure 12-22  Leucine B, Negative.

aminopeptidase (LAP) test. A, Positive.

CHAPTER 12  Overview of Bacterial Identification Methods and Strategies

PROCEDURE 12-23

Litmus Milk Medium Purpose

Appearance of Milk

This test differentiates microorganisms based on various metabolic reactions in litmus milk, including fermentation, reduction, clot formation, digestion, and the formation of gas. Litmus milk is also used to grow lactic acid bacteria.

Consistency of Milk

Principle This test is used to determine an organism’s ability to metabolize litmus milk. Fermentation of lactose is demonstrated when the litmus turns pink as a result of acid production. If sufficient acid is produced, casein in the milk is coagulated, solidifying the milk. With some organisms, the curd shrinks and whey is formed at the surface. Some bacteria hydrolyze casein, causing the milk to become straw colored and resemble turbid serum. In addition, some organisms reduce litmus, in which case the medium becomes colorless in the bottom of the tube. Media: Powdered skim milk (100 g), litmus (0.5 g), sodium sulfite (0.5 g) per 1000 mL, pH 6.8.

Coagulation or clot (Figure 12-23, E) Dissolution of clot with clear, grayish, watery fluid and a shrunken, insoluble pink clot (Figure 12-23, F) Dissolution of clot with grayish, watery fluid and a clear, shrunken, insoluble blue clot

Occurs When pH Is

Record

Acid or alkaline

Clot

Acid

Digestion

Alkaline

Peptonization

Method . Inoculate with four drops of a 24-hour broth culture. 1 2. Incubate at 35°C to 37°C in ambient air. 3. Observe daily for 7 days for alkaline reaction (litmus turns blue), acid reaction (litmus turns pink), indicator reduction, acid clot, rennet clot, and peptonization. Multiple changes can occur over the observation period. 4. Record all changes.

Quality Control Fermentation: Clostridium perfringens (ATCC13124)—gas production Acid: Lactobacillus acidophilus (ATCC11506)—clot formation Peptonization: Pseudomonas aeruginosa (ATCC27853)—clearing Appearance of indicator (litmus dye)

Limitations

A

B

C

D

E

F

Litmus media reactions are not specific and should be followed up with additional tests for definitive identification of microorganisms.

Expected Results

Appearance of Indicator (Litmus Dye) Color

pH Change to

Record

Pink, mauve (Figure 12-23, A) Blue (Figure 12-23, B) Purple (identical to uninoculated control) (Figure 12-23, C) White (Figure 12-23, D)

Acid Alkaline No change

Acid (A) Alkaline (K) No change

Independent of pH Decolorized change; result of reduction of indicator

• Figure 12-23  Litmus milk. A, Acid reaction. B, Alkaline reaction. C, No change. D, Reduction of indicator. E, Clot. (Note separation of clear fluid from clot at arrow.) F, Peptonization.

227

228 PA RT I I I  Bacteriology

PROCEDURE 12-24

Lysine Iron Agar (LIA) Purpose This test is used to differentiate gram-negative bacilli based on decarboxylation or deamination of lysine and the formation of hydrogen sulfide (H2S).

Principle Lysine iron agar contains lysine, peptones, a small amount of glucose, ferric ammonium citrate, and sodium thiosulfate. The medium has an aerobic slant and an anaerobic butt. When glucose is fermented, the butt of the medium becomes acidic (yellow). If the organism produces lysine decarboxylase, cadaverine is formed. Cadaverine neutralizes the organic acids formed by glucose fermentation, and the butt of the medium reverts to the alkaline state (purple). If the decarboxylase is not produced, the butt remains acidic (yellow). If oxidative deamination of lysine occurs, a compound is formed that, in the presence of ferric ammonium citrate and a coenzyme, flavin mononucleotide, forms a burgundy color on the slant. If deamination does not occur, the LIA slant remains purple. Bromocresol purple, the pH indicator, is yellow at or below pH 5.2 and purple at or above pH 6.8. Media: Enzymatic digest of gelatin (5 g), yeast extract (3 g), dextrose (1 g), l-lysine (10 g), ferric ammonium citrate (0.5 g), sodium thiosulfate (0.04 g), bromocresol purple (0.02 g), agar (13.5 g) per 1000 mL, pH 6.7.

Red slant/acid butt (R/A)—lysine deamination and glucose fermentation (Figure 12-24, D).

Limitations Proteus spp. that produce hydrogen sulfide will not blacken the medium. Additional testing, such as triple sugar iron agar, should be used as a follow-up identification method.

Quality Control Alkaline slant and butt: H2S positive: Citrobacter freundii (ATCC8090) Alkaline slant and butt: Escherichia coli (ATCC25922) Alkaline slant and butt: H2S positive: Salmonella typhimurium (ATCC14028) Red slant, acid butt: Proteus mirabilis (ATCC12453)

A

B

C

D

E

Method 1. With a straight inoculating needle, inoculate LIA (Figure 12-24, E) by twice stabbing through the center of the medium to the bottom of the tube and then streaking the slant. 2. Cap the tube tightly and incubate at 35°C to 37°C in ambient air for 18 to 24 hours.

Expected Results Alkaline slant/alkaline butt (K/K)—lysine decarboxylation and no fermentation of glucose (Figure 12-24, A). Alkaline slant/acid butt (K/A)—glucose fermentation (Figure 12-24, C). Note: Patterns shown in Figure 12-24, A and C, can be accompanied by a black precipitate of ferrous sulfide (FeS), which indicates production of H2S (Figure 12-14, B).

• Figure 12-24  Lysine

iron agar. A, Alkaline slant/alkaline butt (K/K). B, Alkaline slant/alkaline butt, H2S positive (K/K H2S1). C, Alkaline slant/acid butt (K/A). D, Red slant/acid butt (R/A). E, Uninoculated tube.

CHAPTER 12  Overview of Bacterial Identification Methods and Strategies

PROCEDURE 12-25

Methyl Red and Voges-Proskauer Tests Purpose The combination test methyl red (MR) and Voges-Proskauer (VP) differentiates members of the Enterobacteriaceae family.

Principle This test is used to determine the ability of an organism to produce and maintain stable acid end products from glucose fermentation, to overcome the buffering capacity of the system, and to determine the ability of some organisms to produce neutral end products (e.g., 2,3-butanediol or acetoin) from glucose fermentation. The methyl red detects mixed acid fermentation that lowers the pH of the broth. The MR indicator is added after incubation. MR is red at pH 4.4 and yellow at pH 6.2. A clear red is a positive result; yellow is a negative result; and various shades of orange are negative or inconclusive. The VP detects the organism’s ability to convert the acid products to acetoin and 2,3-butanediol. Organisms capable of using the VP pathway produce a smaller amount of acid during glucose fermentation and therefore do not produce a color change when the MR indicator is added. A secondary reagent is added, alpha-naphthol, followed by potassium hydroxide (KOH); a positive test result is indicated by a red color complex. Media: Peptic digest of animal tissue (3.5 g), pancreatic digest of casein (3.5 g), dextrose (5 g), KPO4 (5 g) per 1000 mL, pH 6.9.

C. Voges-Proskauer (VP) Test (Coblentz Method) for streptococci

1. Use 24-hour growth from a blood agar plate to heavily inoculate 2 mL of MRVP broth. 2. After 6 hours of incubation at 35°C in ambient air, add 1.2 mL (12 drops) of solution A (alpha-naphthol) and 0.4 mL (four drops) solution B (40% KOH with creatine). 3. Shake the tube and incubate at room temperature for 30 minutes.

Limitations The MR test should not be read before 48 hours, because some organisms will not have produced enough products from the fermentation of glucose. MR-negative organisms may also not have had sufficient time to convert those products and will appear MR positive. MRVP testing should be used in conjunction with other confirmatory tests to differentiate organisms among the Enterobacteriaceae.

Quality Control MR positive/VP negative: Escherichia coli (ATCC25922) MR negative/VP positive: Enterobacter aerogenes (ATCC13048)

Method 1. Inoculate MRVP broth with one drop from a 24-hour brainheart infusion broth culture. 2. Incubate at 35°C to 37°C for a minimum of 48 hours in ambient air. Tests should not be made with cultures incubated less than 48 hours, because the end products build up to detectable levels over time. If results are equivocal at 48 hours, repeat the tests with cultures incubated at 35°C to 37°C for 4 to 5 days in ambient air; in such instances, duplicate tests should be incubated at 25°C. 3. Split broth into aliquots for MR test and VP test.

A. Methyl Red (MR) Test

. Add five or six drops of methyl red reagent per 5 mL of broth. 1 2. Read reaction immediately.

A

B

Expected Results Positive: Bright red color, indicative of mixed acid fermentation (Figure 12-25, A). Weakly positive: Red-orange color. Negative: Yellow color (Figure 12-25, B).

B. Voges-Proskauer (VP) Test (Barritt’s Method) for Gram-Negative Rods

1. Add 0.6 mL (6 drops) of solution A (alpha-naphthol) and 0.2 mL (2 drops) of solution B (KOH) to 1 mL of MRVP broth. 2. Shake well after addition of each reagent. 3. Observe for 5 minutes.

C

Expected Results Positive: Red color, indicative of acetoin production (Figure 12-25, C). Negative: Yellow color (Figure 12-25, D).

• Figure 12-25  Methyl

D

red/Voges-Proskauer (MRVP) tests. A, Positive methyl red. B, Negative methyl red. C, Positive Voges-Proskauer. D, Negative Voges-Proskauer.

229

230 PA RT I I I  Bacteriology

PROCEDURE 12-26

Microdase Test (Modified Oxidase) Purpose

2. Incubate at room temperature for 2 minutes.

This test is used to differentiate gram-positive, catalase-positive cocci (micrococci from staphylococci).

Expected Results

Principle

Positive: Development of blue to purple-blue color (Figure 12-26, A). Negative: No color change (Figure 12-26, B).

The microdase test is a rapid method to differentiate Staphylococcus from Micrococcus spp. by detection of the enzyme oxidase. In the presence of atmospheric oxygen, the oxidase enzyme reacts with the oxidase reagent and cytochrome C to form the colored compound, indophenol.

Limitations

Method

Positive: Micrococcus luteus (ATCC10240) Negative: Staphylococcus aureus (ATCC25923)

1. Using a wooden applicator stick, rub a small amount of several colonies of an 18- to 24-hour pure culture grown on blood agar onto a small area of the microdase disk. Note: Do not rehydrate the disk before use.

Staphylococci should yield a negative color change, except for S. sciuri, S. lentus, and S. vitulus.

Quality Control

A

B

B • Figure 12-26  Microdase test. A, Positive. B, Negative.

CHAPTER 12  Overview of Bacterial Identification Methods and Strategies

PROCEDURE 12-27

Motility Testing Purpose

Quality Control

These tests are used to determine whether an enteric organism is motile. An organism must have flagella to be motile.

Positive: Escherichia coli (ATCC25922) Negative: Staphylococcus aureus (ATCC25923)

Principle The inoculum is stabbed into the center of a semisolid agar deep. Bacterial motility is evident by a diffuse zone of growth extending out from the line of inoculation. Some organisms grow throughout the entire medium, whereas others show small areas or nodules that grow out from the line of inoculation. Media: Enzymatic digest of gelatin (10 g), beef extract (3 g), NaCl (5 g), agar (4 g) per 1000 mL, pH 7.3.

A

B

Method 1. Touch a straight needle to a colony of a young (18- to 24-hour) culture growing on agar medium. 2. Stab once to a depth of only 1/3 to 1/4 inch in the middle of the tube. 3. Incubate at 35°C to 37°C and examine daily for up to 7 days.

Expected Results Positive: Motile organisms will spread out into the medium from the site of inoculation (Figure 12-27, A). Negative: Nonmotile organisms remain at the site of inoculation (Figure 12-27, B).

Limitations Some organisms will not display sufficient growth in this medium to make an accurate determination, and additional follow-up testing is required.

• Figure 12-27  Motility test. A, Positive. B, Negative.

231

232 PA RT I I I  Bacteriology

PROCEDURE 12-28

Lactobacillus MRS Broth Purpose

Quality Control

This test is used to determine whether an organism forms gas during glucose fermentation. Some Lactobacillus spp. and Leuconostoc spp. produce gas.

Positive: Lactobacillus lactis (ATCC19435) Negative: Escherichia coli (ATCC25922)

Principle The MRS broth contains sources of carbon, nitrogen, and vitamins to support the growth of lactobacilli and other organisms. It is a selective medium that uses sodium acetate and ammonium citrate to prevent overgrowth by contaminating organisms. Growth is considered a positive result. A Durham tube may be added to differentiate Lactobacillus spp. from Leuconostoc spp. Media: Enzymatic digest of animal tissue (10 g), beef extract (10 g), yeast extract (5 g), dextrose (20 g), NaC2H3O2 (5 g), polysorbate 80 (1 g), KH2PO4 (2 g), ammonium citrate (2 g), MgSO4 (0.1 g), MnSO4 (0.05 g) per 1000 mL, pH 6.5.

A

B

Method 1. Inoculate MRS broth with an 18- to 24-hour culture from agar or broth. 2. Incubate 24 to 48 hours at 35°C to 37°C in ambient air.

Expected Results Positive: Leuconostoc spp.—growth; gas production indicated by a bubble in the Durham tube (Figure 12-28, A). Positive: Lactobacillus spp.—growth; no gas production (Figure 12-28, B). Negative: No growth (not shown).

• Figure 12-28  MRS broth. A, Positive; gas production by Leuconostoc sp. (arrow). B, Positive: growth, no gas production by Lactobacillus sp.

CHAPTER 12  Overview of Bacterial Identification Methods and Strategies

PROCEDURE 12-29

4-Methylumbelliferyl-b-d-Glucuronide (MUG) Test Purpose

Quality Control

This test is used to presumptively identify various genera of Enterobacteriaceae and verotoxin-producing Escherichia coli.

Positive: Escherichia coli (ATCC25922) Negative: Klebsiella pneumoniae (ATC13883)

Principle E. coli and other Enterobacteriaceae produce the enzyme b-d-glucuronidase, which hydrolyzes b-d-glucopyranosid-uronic derivatives to aglycons and d-glucuronic acid. The substrate 4-methylumbelliferyl-b-d-glucuronide is impregnated into the disk and is hydrolyzed by the enzyme to yield the 4-methylumbelliferyl moiety, which fluoresces blue under long wavelength ultraviolet light. However, verotoxin-producing strains of E. coli do not produce MUG, and a negative test result may indicate the presence of a clinically important strain.

A

B

Method . Wet the disk with one drop of water. 1 2. Using a wooden applicator stick, rub a portion of a colony from an 18- to 24-hour-old pure culture onto the disk. 3. Incubate at 35°C to 37°C in a closed container for up to 2 hours. 4. Observe the disk using a 366-nm ultraviolet light.

Expected Results Positive: Electric blue fluorescence (Figure 12-29, A). Negative: Lack of fluorescence (Figure 12-29, B).

Limitations Do not test colonies isolated from media containing dyes (eosin methylene blue [EMB], MacConkey [MAC]), because it may make the interpretation difficult. Only test on oxidase-positive organisms, because some oxidase-negative organisms naturally fluoresce.

• Figure 12-29  4-Methylumbelliferyl-b-d-Glucuronide A, Positive. B, Negative.

(MUG) test.

233

234 PA RT I I I  Bacteriology

PROCEDURE 12-30

Nitrate Reduction Purpose This test is used to determine the ability of an organism to reduce nitrate to nitrite. All members of the Enterobacteriaceae family reduce nitrate, but some members further metabolize nitrite to other compounds.

Principle Anaerobic metabolism requires an electron acceptor other than atmospheric oxygen (O2). Many gram-negative bacteria use nitrate as the final electron acceptor. The organisms produce nitrate reductase, which converts the nitrate (NO3) to nitrite (NO2). The reduction of nitrate to nitrite is determined by adding sulfanilic acid and alpha-naphthylamine. The sulfanilic acid and nitrite react to form a diazonium salt. The diazonium salt then couples with the alpha-naphthylamine to produce a red, water-soluble azo dye. If no color change occurs, the organism did not reduce nitrate or reduced it further to NH3, NO, or N2O2. Zinc is added at this point; if nitrate remains, the zinc will reduce the compound to nitrite and the reaction will turn positive, indicating a negative test result for nitrate reduction by the organism. If no color change occurs after the addition of zinc, this indicates that the organism reduced nitrate to one of the other nitrogen compounds previously described. A Durham tube is placed in the broth for two reasons: (1) to detect deterioration of the broth before inoculation, as evidenced by gas formation in the tube, and (2) to identify denitrification by organisms that produce gas by alternate pathways; if gas is formed in the tube before the addition of the color indicator, the test result is negative for nitrate reduction by this method. Media: Pancreatic digest of gelatin (20 g), KNO3 (2 g) per 1000 mL.

Method 1. Inoculate nitrate broth with one to two drops from a young broth culture of the test organism. 2. Incubate for 48 hours at 35°C to 37°C in ambient air (some organisms may require longer incubation for adequate growth). Test these cultures 24 hours after obvious growth is detected or after a maximum of 7 days. 3. After a suitable incubation period, test the nitrate broth culture for the presence of gas, reduction of nitrate, and reduction of nitrite according to the following steps: a. Observe the inverted Durham tube for the presence of gas, indicated by bubbles inside the tube. b. Add five drops each of nitrate reagent solution A (sulfanilic acid) and B (alpha-naphthylamine). Observe for at least 3 minutes for a red color to develop. c. If no color develops, test further with zinc powder. Dip a wooden applicator stick into zinc powder and transfer only the amount that adheres to the stick to the nitrate broth culture to which solutions A and B have been added. Observe for at least 3 minutes for a red color to develop. Breaking the stick into the tube after the addition of the zinc provides a useful marker for the stage of testing.

Reaction

NO3 n NO2 (Figure 12-30, A) NO3n NO2, gas partial nongaseous end products NO3n NO2, gaseous end products (Figure 12-30, B) NO3n gaseous end product (Figure 12-30, C) NO3n nongaseous end products NO3n no reaction Uninolculated tube (Figure 12-30, D)

Gas

Color after Addition of Solutions A and B

Color after Addition of Zinc Interpretation —

NO31, no gas

None

Red

NO31, no gas

Yes

Red

NO31, gas

Yes

None

None

NO31, NO21, gas1 C)

None

None

None

NO31, NO21, no gas

None

None

Red

Negative

None

Red

None

Uninoculated tube

Limitations Nitrate reduction is a supportive test for identification of Enterobacteriaceae to the genus level; however, additional follow-up confirmatory testing is required for final identification.

Quality Control Positive: NO31, no gas: Escherichia coli (ATCC25922) Positive: NO31, gas: Pseudomonas aeruginosa (ATCC17588) Negative: Acinetobacter baumannii (ATCC19606)

A

B

C

D

Expected Results The nitrate reduction test is read for the presence or absence of three metabolic products: gas, nitrate (NO3), and nitrite (NO2). The expected results can be summarized as follows:

• Figure 12-30  Nitrate reduction. A, Positive, no gas. B, Positive, gas

(arrow). C, Positive, no color after addition of zinc (arrow). D, Uninoculated tube.

CHAPTER 12  Overview of Bacterial Identification Methods and Strategies

PROCEDURE 12-31

Nitrite Reduction Purpose This test is used to determine whether an organism can reduce nitrites to gaseous nitrogen or to other compounds containing nitrogen.

Principle Microorganisms capable of reducing nitrite to nitrogen do not turn color and do produce gas in the nitrate reduction test (Procedure 12-30). The test does not require the addition of zinc dust. Media: Brain-heart infusion broth (2 g), pancreatic digest of casein (10 g), peptic digest of animal tissue (5 g), yeast extract (3 g), NaCl (5 g), NaNO2 (0.1 g) per 1000 mL, pH 6.9.

not been oxidized to nitrate (thus invalidating the test). If oxidation has occurred, the mixture turns red after the addition of zinc.

Quality Control Positive: Proteus mirabilis (ATCC12453)—colorless; gas production Negative: Acinetobacter baumannii (ATCC19606)—red; no gas production

Method 1. Inoculate nitrite broth with one drop from a 24-hour broth culture. 2. Incubate for 48 hours at 35°C to 37°C. 3. Examine 48-hour nitrite broth cultures for nitrogen gas in the inverted Durham tube and add five drops each of the nitrate reagents A and B to determine whether nitrite is still present in the medium (reagents A and B are described under the nitrate reduction test in Procedure 12-30).

A

B

Expected Results Positive: No color change to red 2 minutes after the addition of the reagents; gas production observed in the Durham tube (Figure 12-31, A). Negative: The broth becomes red after the addition of the reagents. No gas production is observed (Figure 12-31, B).

Limitations If the broth does not become red and no gas production is observed, zinc dust is added to determine whether the nitrite has

• Figure 12-31  Nitrite reduction. A, Positive, no color change after addition of zinc dust and gas in Durham tube (arrow). B, Negative.

235

236 PA RT I I I  Bacteriology

PROCEDURE 12-32

o-Nitrophenyl-b-D-Galactopyranoside (ONPG) Test Purpose

Quality Control

This test is used to determine the ability of an organism to produce b-galactosidase, an enzyme that hydrolyzes the substrate o-nitrophenyl-b-D-galactopyranoside (ONPG) to form a visible (yellow) product, ortho-nitrophenol. The test distinguishes late lactose fermenters from non–lactose fermenters of Enterobacteriaceae.

Positive: Shigella sonnei (ATCC9290) Negative: Salmonella typhimurium (ATCC14028)

Principle Lactose fermenters must be able to transport the carbohydrate (b-galactoside permease) and hydrolyze (b-galactosidase) the lactose to glucose and galactose. Organisms unable to produce b-galactosidase may become genetically altered through a variety of mechanisms and be identified as late-lactose fermenters. ONPG enters the cells of organisms that do not produce the permease but are capable of hydrolyzing the ONPG to galactose and a yellow compound, o-nitrophenol, indicating the presence of b-galactosidase. Media (tube method): Na2HPO4 (9.46 g), phenylalanine (4 g), ONPG (2 g), KH2PO4 (0.907 g) per 1000 mL, pH 8.0.

A

B

Method . 1 2. 3. 4.

Aseptically suspend a loop full of organism in 0.85% saline. Place an ONPG disk in the tube. Incubate for 4 hours at 37°C in ambient air. Examine tubes for a color change.

Expected Results Positive: Yellow (presence of b-galactosidase) (Figure 12-32, A). Negative: Colorless (absence of enzyme) (Figure 12-32, B).

• Figure 12-32  o-Nitrophenyl-b-D-galactopyranoside A, Positive. B, Negative.

(OPNG) test.

CHAPTER 12  Overview of Bacterial Identification Methods and Strategies

PROCEDURE 12-33

Optochin (P disk) Susceptibility Test Purpose

Limitations

This test is used to determine the effect of optochin (ethylhydrocupreine hydrochloride) on an organism. Optochin lyses pneumococci (positive test), but alpha-streptococci are resistant (negative test).

Equivocal: Any zone of inhibition less than 14 mm is questionable for pneumococci; the strain is identified as a pneumococcus with confirmation by a positive bile-solubility test.

Principle Optochin is an antibiotic that interferes with the ATPase and production of adenosine triphosphate (ATP) in microorganisms. The optochin-impregnated disk (TaxoP) is placed on a lawn of organism on a sheep blood agar plate, allowing the antibiotic to diffuse into the medium. The antibiotic inhibits the growth of a susceptible organism, creating a clearing, or zone of inhibition, around the disk. A zone of 14 to 16 mm is considered susceptible and presumptive identification for Streptococcus pneumoniae.

Quality Control Positive: Streptococcus pneumoniae (ATCC6305) Negative: Streptococcus pyogenes (ATCC12384)

A

B

Method 1. Using an inoculating loop, streak two or three suspect colonies of a pure culture onto half of a 5% sheep blood agar plate. 2. Using heated forceps, place an optochin disk in the upper third of the streaked area. Gently tap the disk to ensure adequate contact with the agar surface. 3. Incubate the plate for 18 to 24 hours at 35°C in 5% CO2. Note: Cultures do not grow as well in ambient air, and larger zones of inhibition occur. 4. Measure the zone of inhibition in millimeters, including the diameter of the disk.

Expected Results Positive: Zone of inhibition at least 14 mm in diameter, with 6-mm disk (Figure 12-33, A). Negative: No zone of inhibition (Figure 12-33, B).

• Figure 12-33  Optochin (TaxoP disk) test. A, Streptococcus pneumoniae showing zone of inhibition greater than 14 mm. B, Alphahemolytic Streptococcus spp. growing up to the disk.

237

238 PA RT I I I  Bacteriology

PROCEDURE 12-34

Oxidase Test (Kovac’s Method) Purpose This test determines the presence of cytochrome oxidase activity in microorganisms for the identification of oxidase-negative Enterobacteriaceae, differentiating them from other gram-negative bacilli.

from the agar surface and rub the sample on the filter paper or commercial disk. 3. Observe the inoculated area of paper or disk for a color change to deep blue or purple (Figure 12-34) within 10 seconds (timing is critical).

Principle

Expected Results

To determine the presence of bacterial cytochrome oxidase using the oxidation of the substrate tetramethyl-p-phenylenediamine dihydrochloride to indophenol, a dark purple–colored end product. A positive test (presence of oxidase) is indicated by the development of a dark purple color. No color development indicates a negative test and the absence of the enzyme.

Method 1. Moisten filter paper with the substrate (1% tetramethyl-pphenylenediamine dihydrochloride) or select a commercially available paper disk that has been impregnated with the substrate. 2. Use a platinum wire or wooden stick to remove a small portion of a bacterial colony (preferably not more than 24 hours old)

A

Positive: Development of a dark purple color within 10 seconds (Figure 12-34, A). Negative: Absence of color (Figure 12-34, B).

Limitations Using nickel-base alloy wires containing chromium and iron (nichrome) to rub the colony paste onto the filter paper may cause false-positive results.

Quality Control Positive: Pseudomonas aeruginosa (ATCC27853) Negative: Escherichia coli (ATCC25922)

B

• Figure 12-34  Oxidase test. A, Positive. B, Negative.

CHAPTER 12  Overview of Bacterial Identification Methods and Strategies

PROCEDURE 12-35

Oxidation and Fermentation of Medium (CDC Method) Purpose This test is used to differentiate microorganisms based on the ability to oxidize or ferment specific carbohydrates.

Principle This test is used to determine whether an organism uses carbohydrate substrates to produce acid byproducts. Nonfermentative bacteria are routinely tested for their ability to produce acid from six carbohydrates (glucose, xylose, mannitol, lactose, sucrose, and maltose). In addition to the six tubes containing carbohydrates, a control tube containing the OF base without carbohydrate is also inoculated. Triple sugar iron (TSI) agar (see Procedure 12-41) is also used to determine whether an organism can ferment glucose. OF glucose is used to determine whether an organism ferments (Figure 12-35, A) or oxidizes (Figure 12-35, B) glucose. If no reaction occurs in either the TSI or OF glucose, the organism is considered a non–glucose utilizer (Figure 12-35, C). Hugh and Leifson’s formula uses a low peptone-to-carbohydrate ratio and a limiting amount of carbohydrate. The reduced peptone limits the formation of alkaline amines that may mask acid production resulting from oxidative metabolism. Two tubes are required for interpretation of the OF test. Both are inoculated, and one tube is overlaid with mineral oil, producing an anaerobic environment. Production of acid in the overlaid tube results in a color change and is an indication of fermentation. Acid production in the open tube and color change is the result of oxidation. Media: Pancreatic digest of casein (2 g), glycerol (10.0 mL), phenol red (King method) (0.03 g), agar (3 g) per 1000 mL, pH 7.3.

Method

Weak-positive (Aw): Weak acid formation can be detected by comparing the tube containing the medium with carbohydrate with the inoculated tube containing medium with no carbohydrate. Most bacteria that can grow in the OF base produce an alkaline reaction in the control tube. If the color of the medium in a tube containing carbohydrate remains about the same as it was before the medium was inoculated and if the inoculated medium in the control tube becomes a deeper red (i.e., becomes alkaline), the culture being tested is considered weakly positive, assuming the amount of growth is about the same in both tubes. Negative: Red or alkaline (K) color in the deep with carbohydrate equal to the color of the inoculated control tube. No change (NC) or neutral (N): There is growth in the media, but neither the carbohydrate-containing medium nor the control base turns alkaline (red). Note: If the organism does not grow at all in the OF medium, mark the reaction as no growth (NG).

Limitations Slow-growing organisms may not produce results for several days.

Quality Control Note: Appropriate organisms depend on which carbohydrate has been added to the basal medium. Glucose is used as an example. Fermenter: Escherichia coli (ATCC25922) Oxidizer: Pseudomonas aeruginosa (ATCC27853)

A

B

C

1. To determine whether acid is produced from carbohydrates, inoculate agar deeps, each containing a single carbohydrate, with bacterial growth from an 18- to 24-hour culture by stabbing a needle four to five times into the medium to a depth of 1 cm. Note: Two tubes of OF dextrose are usually inoculated; one is overlaid with either sterile melted petrolatum or sterile paraffin oil to detect fermentation. 2. Incubate the tubes at 35°C to 37°C in ambient air for up to 7 days. Note: If screwcap tubes are used, loosen the caps during incubation to allow for air exchange. Otherwise, the control tube and tubes containing carbohydrates that are not oxidized might not become alkaline.

Expected Results Positive: Acid production (A) is indicated by the color indicator changing to yellow in the carbohydrate-containing deep.

• Figure 12-35  Oxidation

and fermentation medium (CDC method). A, Fermenter. B, Oxidizer. C, Nonutilizer.

239

240 PA RT I I I  Bacteriology

PROCEDURE 12-36

Phenylalanine Deaminase Agar (PDA) Purpose This test is used to determine the ability of an organism to oxidatively deaminate phenylalanine to phenylpyruvic acid. The genera Morganella, Proteus, and Providencia can be differentiated from other members of the Enterobacteriaceae family.

Negative: Slant remains original color after the addition of ferric chloride (Figure 12-36, B).

Quality Control Positive: Proteus mirabilis (ATCC12453) Negative: Escherichia coli (ATCC25922)

Principle Microorganisms that produce phenylalanine deaminase remove the amine (NH2) from phenylalanine. The reaction results in the production of ammonia (NH3) and phenylpyruvic acid. The phenylpyruvic acid is detected by adding a few drops of 10% ferric chloride; a green-colored complex is formed between these two compounds. Media: Phenylalanine (2 g), yeast extract (3 g), NaCl (5 g), Na3PO4 (1 g), agar (12 g) per 1000 mL, pH 7.3.

A

B

Method 1. Inoculate phenylalanine slant with one drop of a 24-hour brain-heart infusion broth. 2. Incubate 18 to 24 hours (or until good growth is apparent) at 35°C to 37°C in ambient air with the cap loose. 3. After incubation, add four to five drops of 10% aqueous ferric chloride to the slant.

Expected Results Positive: Green color develops on slant after ferric chloride is added (Figure 12-36, A).

• Figure 12-36  Phenylalanine deaminase. A, Positive. B, Negative.

CHAPTER 12  Overview of Bacterial Identification Methods and Strategies

PROCEDURE 12-37

l-Pyrrolidonyl Arylamidase (PYR) Test Purpose This test is used for the presumptive identification of group A streptococci (Streptococcus pyogenes) and enterococci by the presence of the enzyme l-pyrrolidonyl arylamidase.

Principle The enzyme l-pyrrolidonyl arylamidase hydrolyzes the l-pyrrolidonyl-b-naphthylamide substrate to produce a b-naphthylamine. The b-naphthylamine can be detected in the presence of N,N-methylamino-cinnamaldehyde reagent by the production of a bright red precipitate.

Method

. Incubate at room temperature for 2 minutes. 3 4. Add a drop of detector reagent, N,N-dimethylaminocinnamaldehyde, and observe for a red color within 1 minute.

Expected Results Positive: Bright red color within 5 minutes (Figure 12-37, A). Negative: No color change or an orange color (Figure 12-37, B).

Quality Control Positive: Enterococcus faecalis (ATCC29212) Streptococcus pyogenes (ATCC19615) Negative: Streptococcus agalactiae (ATCC10386)

1. Before inoculation, moisten the disk slightly with reagentgrade water. Do not flood the disk. 2. Using a wooden applicator stick, rub a small amount of several colonies of an 18- to 24-hour pure culture onto a small area of the PYR disk.

A

B

• Figure 12-37  l-Pyrrolidonyl arylamidase (PYR) test. A, Positive. B, Negative.

241

242 PA RT I I I  Bacteriology

PROCEDURE 12-38

Pyruvate Broth Pur